7th World Congress on Genetics Applied to Livestock Production, August dịch - 7th World Congress on Genetics Applied to Livestock Production, August Việt làm thế nào để nói

7th World Congress on Genetics Appl

7th World Congress on Genetics Applied to Livestock Production, August 19-23, 2002, Montpellier, France



A MEISHAN POSITIVE QTL FOR PROLIFICACY TRAITS FOUND AT THE NCOA1 LOCUS ON SSC 3.


J.S. Melville1, A.M.V. Gibbins1, J.A.B. Robinson1, J.P. Gibson1,3, A.L. Archibald2, C.S. Haley2 and Z. Jiang1

1 CGIL, Department of Animal and Poultry Science, University of Guelph, Guelph, Ontario, Canada N1G 2W1
2 Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, UK
3 International Livestock Research Institute, P.O. Box 30709, Nairobi, Kenya

INTRODUCTION
Sow productivity, specifically litter size, is of great importance to the success of the swine industry. Sow productivity, defined as the number of live births per sow per year, involves the animal’s age at puberty, conception rate, ovulation rate, embryo survival, number of piglets born, number stillborn, number born alive, birth weight, and weaning to service interval. The Chinese Meishan pig has a lower carcass value by Western standards but has a litter size approximately 4 piglets larger than North American breeds, 0.4 fewer stillborn, matures early, and commonly has two litters per year, all economically important traits. The incorporation of Meishan characteristics into North American breeding lines has been only moderately effective; common cross breeding programs have failed to incorporate these favourable traits while avoiding the deleterious carcass quality traits inherent in the Meishan animals.

Reproductive traits are known to be controlled by many genes. A number of genes have been investigated as possible sources of genetic improvement for prolificacy traits. The positive association found between the estrogen receptor gene (ESR) and litter size in pigs (Rothschild et al., 1996) is a significant finding with regard to potential increases in animal productivity. The porcine gonadotrophin-releasing hormone receptor gene (GNRHR) has also been found to be associated with the number of corpora lutea formed (Jiang et al., 2001). There are genes that map to SSC 3 that have been identified as being associated with reproductive traits, such as the follicle stimulating hormone receptor gene (FSHR) (Remy et al., 1995) and the luteinizing hormone/choriogonadotropin receptor gene (LH-CGR) (Yerle et al., 1992). LH-CGR is involved in signaling pathways in ovarian follicles (Rajagopalan-Gupta et al., 1998). A project involving porcine genome scanning for quantitative trait loci (QTL) associated with reproduction in swine, reported in Rohrer et al. (1999), identified 5 regions of which 4 showed Large White composite QTL alleles to be superior to Meishan QTL alleles for ovulation rate.

The nuclear receptor coactivator 1 gene (NCOA1), also know as the steroid receptor coactivator 1 gene (SRC1), is a candidate gene for influence on swine reproduction traits and has been mapped to SSC3. The human NCOA1 gene is comprised of 22 exons with a total genomic length of 183.4 Kb, and a cDNA length of approximately 4721 bp. The nuclear receptor coactivator-1 gene is a likely choice to be investigated as a candidate gene for influence on swine prolificacy traits. The NCOA1 complex interacts with the DNA-bound estrogen receptor serving to enhance its transcriptional activation function (Leo and Chen, 2000). The NCOA1



Session 08. Reproduction Communication N° 08-26

7th World Congress on Genetics Applied to Livestock Production, August 19-23, 2002, Montpellier, France



protein performs histone acetylation and interacts with another acetyltransferase, p300/CBP, in the process of exposing the otherwise inaccessible chromatin (Spencer et al., 1997). Thus, the NCOA 1 protein enhances activity of the ESR receptor that, in turn, stimulates the transcription of specific estrogen-responsive genes and mediates subsequent physiological responses (Nephew et al., 2000). Here we report on a Meishan positive locus associated with prolificacy traits found on SSC 3 at the NCOA1 locus.

MATERIALS AND METHODS
Primer Design. Through GenBank, a DNA sequence database provided by the National Centre for Biotechnology Information (NCBI), we have been able to obtain the entire genomic and cDNA sequence of the human NCOA1 gene. Using DNA sequence comparison tools available from NCBI we identified cattle sequences that have high homology to the human NCOA1 sequence and designed universal oligonucleotide primers that are able to amplify corresponding fragments of the porcine genome. Primer design was conducted using the online oligonucleotide design tool Primer3 (Rozen and Skaletsky, 1998). The forward primer used has the sequence 5’ AGGGGCTACCCTCCTGTAAG, and the reverse primer is 5’ CTTCTCTGCCAGTTCTCCAGTC.

Polymerase Chain Reactions. A fragment of exon 11 of the NCOA1 gene was amplified using the specific primer sequences cited previously. The PCR conditions consisted of 10 µL reactions each consisting of approximately 60 ng genomic DNA, 75 ng of both the forward and reverse primers, 200 nM dNTPs, 2.5 mM MgCl2, 1.0 µL 10X PCR buffer, and 0.5 U AmpliTaq DNA Polymerase (Applied Biosystems, Foster City, USA). After an initial denaturing step of 94oC for 3 minutes, the elongation cycling conditions for the PCR reaction were 8 cycles of touchdown at 94 oC for 30 s, 63 oC-56 oC for 30 s, 72 oC for 30 s, and 32 cycles of 94 oC for 30 s, 55 oC for 30 s, and 72 oC for 30 s. An elongation step of 72 oC for 5 minutes was included for the final step.

Sequencing of Amplified DNA Fragments. The designed primers were used to amplify and sequence DNA fragments from pooled porcine genomic DNA. The two DNA pools consisted of either 20 Ehuralien or 20 Landrace samples. For each mix the DNA was prepared from blood samples. Once DNA fragments had been cleanly amplified, the fragments were sequenced using an ABI 377 automated sequencer located at the Guelph Molecular Supercentre, University of Guelph. The sequences obtained from the Ehuralien and Landrace pooled DNA samples were compared for any polymorphisms and intron/exon borders were determined.

Genotyping of Animals. Within exon 11 a single nucleotide polymorphism (a T/C substitution) was identified. The PCR-RFLP technique was determined to be the most effective method of genotyping animals for the polymorphism. The restriction enzyme Rsa1 was identified to be able to cleave the DNA if a cytosine base is present in place of thymine, as shown in Figure 1. Restriction digestions were carried out at 37 oC for 3 hours.

Animal Population. The animal population was developed by the Roslin Institute, Scotland, and consisted of a Meishan x Large White three generation crossbreeding population with 30



Session 08. Reproduction Communication N° 08-26

7th World Congress on Genetics Applied to Livestock Production, August 19-23, 2002, Montpellier, France



grandparent animals of which 16 were pure Meishan and 14 were pure Large White. The 30 grandparent pigs and 220 F2 sows were used for genotyping and the results analyzed for association with phenotypic data regarding prolificacy traits previously recorded. Statistical analysis was completed using the genotyping data from 178 animals from the Roslin population for which ovulation rate data was recorded.

RESULTS AND DISCUSSION
Sequencing of PCR-amplified DNA from the Meishan and Large White pooled samples revealed a T/C single nucleotide polymorphism (SNP) located in exon 11 of the NCOA1 gene. The SNP was determined to be a silent mutation, and analysis was continued based on the logic of using the mutation as a molecular marker.

Statistical analysis was done on the NCOA1 genotyping records of 178 animals from the Roslin Meishan x Large White population. Analysis was done using Statistical Analysis Software (SAS), with a model fitting the effects of weight at laparoscopy and year with the NCOA1 genotype on ovulation rate. The A1A1 genotype (T/T) was found to account for an increase of 2.17 corpora lutea (CP), significantly different from the A2A2 genotype (C/C) value of 16.45 CP (p=0.0087), while the A1A2 genotype (T/C) showed an average increase of 0.90, CP although this increase was not found to be significant. Analysis of the population genotypes and the recorded number born (NB) showed a similar trend, but the results were not found to be significant. The A1A1 genotype showed an increase of 1.82 NB, approaching significance (p=0.1045) as compared to the A2A2 genotype value of 12.38 NB. The A1A2 genotype had an increase of 0.90 NB.

1 2 3 4 5 6 7 8 9











Figure 1. An agarose gel showing the NCOA1 exon 11 Rsa1 polymorphism in eight grandparent animals. Lane 1 contains a 100 bp standard marker, lanes 2, 5, and 9 refer to Meishan (M) animals with the genotype A1A1, lane 6 refers to a M animal with the A1A2 genotype, and lanes 3, 4, 7, and 8 refer to Large White animals with the genotype A2A2

A nuclear receptor coactivator enhances transcriptional activation by interacting with nuclear receptors bound to DNA. The nuclear receptors that are affected, such as the estrogen receptor, androgen receptor, and thyroid receptor, play important roles in a wide variety of biological



Session 08. Reproduction Communication N° 08-26


The trial version converts only 3 pages. Evaluation only.
Converted by First PDF.
(Licensed version doesn't display this notice!)

Click to get the license for First PDF.
0/5000
Từ: -
Sang: -
Kết quả (Việt) 1: [Sao chép]
Sao chép!
7th World Congress on Genetics Applied to Livestock Production, August 19-23, 2002, Montpellier, FranceA MEISHAN POSITIVE QTL FOR PROLIFICACY TRAITS FOUND AT THE NCOA1 LOCUS ON SSC 3.J.S. Melville1, A.M.V. Gibbins1, J.A.B. Robinson1, J.P. Gibson1,3, A.L. Archibald2, C.S. Haley2 and Z. Jiang11 CGIL, Department of Animal and Poultry Science, University of Guelph, Guelph, Ontario, Canada N1G 2W12 Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, UK3 International Livestock Research Institute, P.O. Box 30709, Nairobi, KenyaINTRODUCTIONSow productivity, specifically litter size, is of great importance to the success of the swine industry. Sow productivity, defined as the number of live births per sow per year, involves the animal’s age at puberty, conception rate, ovulation rate, embryo survival, number of piglets born, number stillborn, number born alive, birth weight, and weaning to service interval. The Chinese Meishan pig has a lower carcass value by Western standards but has a litter size approximately 4 piglets larger than North American breeds, 0.4 fewer stillborn, matures early, and commonly has two litters per year, all economically important traits. The incorporation of Meishan characteristics into North American breeding lines has been only moderately effective; common cross breeding programs have failed to incorporate these favourable traits while avoiding the deleterious carcass quality traits inherent in the Meishan animals.Reproductive traits are known to be controlled by many genes. A number of genes have been investigated as possible sources of genetic improvement for prolificacy traits. The positive association found between the estrogen receptor gene (ESR) and litter size in pigs (Rothschild et al., 1996) is a significant finding with regard to potential increases in animal productivity. The porcine gonadotrophin-releasing hormone receptor gene (GNRHR) has also been found to be associated with the number of corpora lutea formed (Jiang et al., 2001). There are genes that map to SSC 3 that have been identified as being associated with reproductive traits, such as the follicle stimulating hormone receptor gene (FSHR) (Remy et al., 1995) and the luteinizing hormone/choriogonadotropin receptor gene (LH-CGR) (Yerle et al., 1992). LH-CGR is involved in signaling pathways in ovarian follicles (Rajagopalan-Gupta et al., 1998). A project involving porcine genome scanning for quantitative trait loci (QTL) associated with reproduction in swine, reported in Rohrer et al. (1999), identified 5 regions of which 4 showed Large White composite QTL alleles to be superior to Meishan QTL alleles for ovulation rate.The nuclear receptor coactivator 1 gene (NCOA1), also know as the steroid receptor coactivator 1 gene (SRC1), is a candidate gene for influence on swine reproduction traits and has been mapped to SSC3. The human NCOA1 gene is comprised of 22 exons with a total genomic length of 183.4 Kb, and a cDNA length of approximately 4721 bp. The nuclear receptor coactivator-1 gene is a likely choice to be investigated as a candidate gene for influence on swine prolificacy traits. The NCOA1 complex interacts with the DNA-bound estrogen receptor serving to enhance its transcriptional activation function (Leo and Chen, 2000). The NCOA1Session 08. Reproduction Communication N° 08-26 7th World Congress on Genetics Applied to Livestock Production, August 19-23, 2002, Montpellier, Franceprotein performs histone acetylation and interacts with another acetyltransferase, p300/CBP, in the process of exposing the otherwise inaccessible chromatin (Spencer et al., 1997). Thus, the NCOA 1 protein enhances activity of the ESR receptor that, in turn, stimulates the transcription of specific estrogen-responsive genes and mediates subsequent physiological responses (Nephew et al., 2000). Here we report on a Meishan positive locus associated with prolificacy traits found on SSC 3 at the NCOA1 locus.MATERIALS AND METHODSPrimer Design. Through GenBank, a DNA sequence database provided by the National Centre for Biotechnology Information (NCBI), we have been able to obtain the entire genomic and cDNA sequence of the human NCOA1 gene. Using DNA sequence comparison tools available from NCBI we identified cattle sequences that have high homology to the human NCOA1 sequence and designed universal oligonucleotide primers that are able to amplify corresponding fragments of the porcine genome. Primer design was conducted using the online oligonucleotide design tool Primer3 (Rozen and Skaletsky, 1998). The forward primer used has the sequence 5’ AGGGGCTACCCTCCTGTAAG, and the reverse primer is 5’ CTTCTCTGCCAGTTCTCCAGTC.
Polymerase Chain Reactions. A fragment of exon 11 of the NCOA1 gene was amplified using the specific primer sequences cited previously. The PCR conditions consisted of 10 µL reactions each consisting of approximately 60 ng genomic DNA, 75 ng of both the forward and reverse primers, 200 nM dNTPs, 2.5 mM MgCl2, 1.0 µL 10X PCR buffer, and 0.5 U AmpliTaq DNA Polymerase (Applied Biosystems, Foster City, USA). After an initial denaturing step of 94oC for 3 minutes, the elongation cycling conditions for the PCR reaction were 8 cycles of touchdown at 94 oC for 30 s, 63 oC-56 oC for 30 s, 72 oC for 30 s, and 32 cycles of 94 oC for 30 s, 55 oC for 30 s, and 72 oC for 30 s. An elongation step of 72 oC for 5 minutes was included for the final step.

Sequencing of Amplified DNA Fragments. The designed primers were used to amplify and sequence DNA fragments from pooled porcine genomic DNA. The two DNA pools consisted of either 20 Ehuralien or 20 Landrace samples. For each mix the DNA was prepared from blood samples. Once DNA fragments had been cleanly amplified, the fragments were sequenced using an ABI 377 automated sequencer located at the Guelph Molecular Supercentre, University of Guelph. The sequences obtained from the Ehuralien and Landrace pooled DNA samples were compared for any polymorphisms and intron/exon borders were determined.

Genotyping of Animals. Within exon 11 a single nucleotide polymorphism (a T/C substitution) was identified. The PCR-RFLP technique was determined to be the most effective method of genotyping animals for the polymorphism. The restriction enzyme Rsa1 was identified to be able to cleave the DNA if a cytosine base is present in place of thymine, as shown in Figure 1. Restriction digestions were carried out at 37 oC for 3 hours.

Animal Population. The animal population was developed by the Roslin Institute, Scotland, and consisted of a Meishan x Large White three generation crossbreeding population with 30



Session 08. Reproduction Communication N° 08-26

7th World Congress on Genetics Applied to Livestock Production, August 19-23, 2002, Montpellier, France



grandparent animals of which 16 were pure Meishan and 14 were pure Large White. The 30 grandparent pigs and 220 F2 sows were used for genotyping and the results analyzed for association with phenotypic data regarding prolificacy traits previously recorded. Statistical analysis was completed using the genotyping data from 178 animals from the Roslin population for which ovulation rate data was recorded.

RESULTS AND DISCUSSION
Sequencing of PCR-amplified DNA from the Meishan and Large White pooled samples revealed a T/C single nucleotide polymorphism (SNP) located in exon 11 of the NCOA1 gene. The SNP was determined to be a silent mutation, and analysis was continued based on the logic of using the mutation as a molecular marker.

Statistical analysis was done on the NCOA1 genotyping records of 178 animals from the Roslin Meishan x Large White population. Analysis was done using Statistical Analysis Software (SAS), with a model fitting the effects of weight at laparoscopy and year with the NCOA1 genotype on ovulation rate. The A1A1 genotype (T/T) was found to account for an increase of 2.17 corpora lutea (CP), significantly different from the A2A2 genotype (C/C) value of 16.45 CP (p=0.0087), while the A1A2 genotype (T/C) showed an average increase of 0.90, CP although this increase was not found to be significant. Analysis of the population genotypes and the recorded number born (NB) showed a similar trend, but the results were not found to be significant. The A1A1 genotype showed an increase of 1.82 NB, approaching significance (p=0.1045) as compared to the A2A2 genotype value of 12.38 NB. The A1A2 genotype had an increase of 0.90 NB.

1 2 3 4 5 6 7 8 9











Figure 1. An agarose gel showing the NCOA1 exon 11 Rsa1 polymorphism in eight grandparent animals. Lane 1 contains a 100 bp standard marker, lanes 2, 5, and 9 refer to Meishan (M) animals with the genotype A1A1, lane 6 refers to a M animal with the A1A2 genotype, and lanes 3, 4, 7, and 8 refer to Large White animals with the genotype A2A2

A nuclear receptor coactivator enhances transcriptional activation by interacting with nuclear receptors bound to DNA. The nuclear receptors that are affected, such as the estrogen receptor, androgen receptor, and thyroid receptor, play important roles in a wide variety of biological



Session 08. Reproduction Communication N° 08-26


The trial version converts only 3 pages. Evaluation only.
Converted by First PDF.
(Licensed version doesn't display this notice!)

Click to get the license for First PDF.
đang được dịch, vui lòng đợi..
Kết quả (Việt) 2:[Sao chép]
Sao chép!
7 Đại hội Thế giới về Di truyền học ứng dụng để sản xuất chăn nuôi, ngày 19-ngày 23 tháng 8, 2002, Montpellier, Pháp A Mi Sơn TÍCH CỰC QTL đối với tính trạng sự sản xuất nhiều FOUND AT THE NCOA1 locus trên SSC 3. JS Melville1, AMV Gibbins1, JAB Robinson1, JP Gibson1,3, AL Archibald2, CS Haley2 và Z. Jiang1 1 CGIL, Cục Thú và khoa học gia cầm, Đại học Guelph, Guelph, Ontario, Canada N1G 2W1 2 Viện Roslin (Edinburgh), Roslin, Midlothian EH25 9PS, Anh 3 Viện nghiên cứu chăn nuôi quốc tế, PO Box 30.709, Nairobi, Kenya GIỚI THIỆU suất Sow, cụ thể kích thước ổ đẻ, là rất quan trọng cho sự thành công của ngành chăn nuôi lợn. Gieo suất, định nghĩa là số người sinh sống mỗi lợn nái mỗi năm, liên quan đến tuổi tác của con vật ở tuổi dậy thì, tỷ lệ thụ thai, tỷ lệ rụng trứng, sự sống của phôi, số lợn con sinh ra, số chết non, số sinh sống, cân nặng khi sinh và cai sữa đến dịch vụ khoảng thời gian. Người Trung Quốc Meishan lợn có một giá trị xác thấp hơn so với tiêu chuẩn phương Tây, nhưng có một số con đẻ khoảng 4 heo con lớn hơn giống Bắc Mỹ, 0,4 ít bị chết non, chín sớm, và thường có hai lít mỗi năm, tất cả những đặc điểm quan trọng về mặt kinh tế. Sự kết hợp của Mi Sơn đặc vào dòng giống Bắc Mỹ đã được chỉ vừa phải có hiệu quả; chương trình nhân giống chéo thông thường đã thất bại trong việc kết hợp những đặc tính có lợi trong khi tránh các đặc tính chất lượng thịt có hại vốn có trong các loài động vật Mi Sơn. đặc điểm sinh sản được biết là bị kiểm soát bởi nhiều gen. Một số gen đã được nghiên cứu như các nguồn có thể cải thiện di truyền các tính trạng sự sản xuất nhiều. Các liên kết tích cực tìm thấy giữa các gen thụ thể estrogen (ESR) và lứa đẻ ở lợn (Rothschild et al., 1996) là một phát hiện quan trọng liên quan đến sự gia tăng tiềm năng năng suất chăn nuôi với. Các lợn gonadotrophin-releasing hormone gen thụ thể (GNRHR) cũng đã được tìm thấy có liên quan với số lượng lutea corpora hình thành (Jiang et al., 2001). Có gen bản đồ để SSC 3 đã được xác định như gắn liền với đặc điểm sinh sản, chẳng hạn như kích thích nang gen thụ thể hormon (FSHR) (Remy et al., 1995) và gen thụ thể luteinizing hormone / choriogonadotropin (LH-CGR ) (Yerle et al., 1992). LH-CGR được tham gia vào tín hiệu trong các nang buồng trứng (Rajagopalan-Gupta et al., 1998). Một dự án liên quan đến lợn quét bộ gen của locus tính trạng số lượng (QTL) liên kết với sinh sản ở lợn, báo cáo trong Rohrer et al. (1999), xác định 5 khu vực trong đó có 4 cho thấy lớn alen trắng hỗn QTL để được cấp trên để Meishan QTL alen cho tỷ lệ rụng trứng. Các thụ thể hạt nhân coactivator 1 gen (NCOA1), cũng được biết như là các steroid thụ coactivator 1 gen (SRC1), là một gen ứng cử viên cho ảnh hưởng đến các tính trạng sinh sản lợn và đã được ánh xạ tới SSC3. Gen NCOA1 con người bao gồm 22 exon với tổng chiều dài của gen 183,4 Kb, và chiều dài cDNA của khoảng 4721 bp. Các thụ thể hạt nhân coactivator-1 gen là một sự lựa chọn có thể được điều tra như một gen ứng cử viên cho ảnh hưởng đến các tính trạng sự sản xuất nhiều lợn. Khu phức hợp NCOA1 tương tác với các thụ thể estrogen DNA-ràng buộc phục vụ để tăng cường chức năng hoạt hóa phiên mã của nó (Leo và Chen, 2000). Các NCOA1 phiên 08. Sinh sản Truyền N ° 08-26 lần thứ 7 Đại hội thế giới về Di truyền học ứng dụng để sản xuất chăn nuôi, 19-ngày 23 tháng tám năm 2002, Montpellier, Pháp protein thực acetyl hóa histone và tương tác với nhau acetyltransferase, P300 / CBP, trong quá trình phơi nhiễm sắc không thể tiếp cận (Spencer et al., 1997). Do đó, các protein NCOA 1 tăng cường hoạt động của các thụ thể ESR đó, lần lượt, kích thích sự phiên mã của gen estrogen đáp ứng cụ thể và trung gian phản ứng sinh lý tiếp theo (Nephew et al., 2000). Dưới đây chúng tôi báo cáo về một locus dương Mi Sơn kết hợp với đặc điểm sự sản xuất nhiều tìm thấy trên SSC 3 tại locus NCOA1. VẬT LIỆU VÀ PHƯƠNG PHÁP Primer Design. Qua GenBank, một cơ sở dữ liệu trình tự DNA được cung cấp bởi Trung tâm Quốc gia về Thông tin Công nghệ sinh học (NCBI), chúng tôi đã có thể để có được toàn bộ chuỗi gen và cDNA của gen NCOA1 con người. Sử dụng trình tự DNA công cụ so sánh sẵn từ NCBI chúng tôi xác định trình tự gia súc có tính tương đồng cao với chuỗi NCOA1 nhân lực và thiết kế mồi oligonucleotide phổ quát mà có thể khuếch đại các đoạn tương ứng của bộ gen lợn. Thiết kế Primer được tiến hành bằng cách sử dụng các công cụ thiết kế trực tuyến oligonucleotide Primer3 (Rozen và Skaletsky, 1998). Các mồi xuôi sử dụng có trình tự 5 'AGGGGCTACCCTCCTGTAAG, và mồi ngược lại là 5' CTTCTCTGCCAGTTCTCCAGTC. Polymerase Chain phản ứng. Một mảnh của exon 11 của gen NCOA1 được khuếch đại bằng cách sử dụng các trình tự mồi cụ thể được trích dẫn trước đây. Các điều kiện PCR gồm 10 phản ứng ml mỗi bao gồm khoảng 60 ng DNA của bộ gen, 75 ng của cả hai phía trước và ngược mồi, 200 nM dNTP, 2,5 mM MgCl2, 1.0 đệm ml 10X PCR, và 0,5 U AmpliTaq DNA Polymerase (Applied Biosystems , Thành phố Foster, USA). Sau một bước biến tính ban đầu của 94oC trong 3 phút, các điều kiện kéo dài đi xe đạp cho các phản ứng PCR là 8 chu kỳ của touchdown 94 oC trong 30 s, 63 oC-56 oC trong 30 s, 72 oC trong 30 s, và 32 chu kỳ của 94 oC trong 30 s, 55 oC trong 30 s, và 72 oC trong 30 s. Một bước đi kéo dài 72 oC trong 5 phút đã được bao gồm cho bước cuối cùng. Sequencing của Amplified Fragments DNA. Các mồi thiết kế đã được sử dụng để khuếch đại và các mảnh vỡ DNA chuỗi từ gộp DNA của bộ gen lợn. Hai hồ DNA gồm cả 20 Ehuralien hoặc 20 mẫu Landrace. Đối với mỗi trộn DNA đã được chuẩn bị từ mẫu máu. Một khi các mảnh DNA đã được khuếch đại sạch, các mảnh vỡ đã được giải trình tự bằng cách sử dụng một ABI 377 sequencer tự động đặt tại Guelph Molecular Supercentre, Đại học Guelph. Các trình tự thu được từ Ehuralien và Landrace gộp các mẫu DNA được so sánh với bất kỳ đa hình và biên giới intron / exon được xác định. Định kiểu gen của loài vật. Trong thời hạn 11 exon là đa hình nucleotit (thay thế một T / C) đã được xác định. Kỹ thuật PCR-RFLP được xác định là phương pháp hiệu quả nhất của kiểu gen động vật cho đa hình. Các enzyme giới hạn Rsa1 đã được xác định để có thể tách những DNA nếu một cơ sở cytosine có mặt ở vị trí của thymine, như thể hiện trong hình 1. Hạn chế phá mẫu được thực hiện ở 37 oC trong 3 giờ. Animal Dân số. Các quần thể động vật được phát triển bởi Viện Roslin, Scotland, và bao gồm một Meishan x Large White ba thế hệ dân lai với 30 phiên 08. Sinh sản Truyền N ° 08-26 lần thứ 7 Đại hội thế giới về Di truyền học ứng dụng để sản xuất chăn nuôi, 19-ngày 23 tháng 8 năm 2002, Montpellier, Pháp vật ông bà trong đó 16 là tinh khiết Mi Sơn và 14 trong sạch Large White. 30 lợn ông bà và 220 lợn nái F2 đã được sử dụng cho kiểu gen và các kết quả phân tích cho kết hợp với dữ liệu kiểu hình liên quan đến đặc điểm sự sản xuất nhiều ghi nhận trước đây. Phân tích thống kê được hoàn thành bằng cách sử dụng dữ liệu kiểu gen từ 178 loài động vật từ các dân Roslin mà số liệu tỷ lệ rụng trứng đã được ghi lại. KẾT QUẢ VÀ THẢO LUẬN Giải mã bộ gen PCR-khuếch đại DNA từ Meishan và Large White gộp mẫu tiết lộ một T / C đơn đa hình nucleotide (SNP ) nằm trong exon 11 của gen NCOA1. Các SNP được xác định là một đột biến im lặng, và phân tích được tiếp tục dựa trên logic của việc sử dụng các đột biến như một marker phân tử. Phân tích thống kê được thực hiện trên các bản ghi kiểu gen NCOA1 của 178 loài động vật từ Roslin Meishan x dân trắng lớn. Việc phân tích được thực hiện bằng cách sử dụng phân tích thống kê phần mềm (SAS), với một mô hình phù hợp ảnh hưởng của cân nặng lúc nội soi và năm với các kiểu gen NCOA1 về tỷ lệ rụng trứng. Các kiểu gen A1A1 (T / T) đã được tìm thấy vào tài khoản cho tăng 2,17 thể vàng (CP), khác nhiều so với kiểu gen A2A2 (C / C) giá trị 16,45 CP (p = 0,0087), trong khi các kiểu gen A1A2 (T / C) cho thấy một sự gia tăng trung bình 0,90, CP mặc dù mức tăng này không được tìm thấy là có ý nghĩa. Phân tích các kiểu gen dân số và số lượng ghi sinh (NB) cho thấy một xu hướng tương tự, nhưng kết quả không được tìm thấy là có ý nghĩa. Các kiểu gen A1A1 cho thấy tăng 1,82 NB, tiếp cận có ý nghĩa (p = 0,1045) so với giá trị kiểu gen A2A2 của 12,38 NB. Các kiểu gen A1A2 đã tăng 0,90 NB. 1 2 3 4 5 6 7 8 9 Hình 1. Một gel agarose cho thấy NCOA1 exon 11 Rsa1 đa hình trong tám vật ông bà. Ngõ 1 chứa một dấu chuẩn 100 bp, làn xe 2, 5, và 9 tham khảo Mi Sơn (M) động vật với những A1A1 kiểu gen, ngõ 6 đề cập đến một con vật M với các kiểu gen A1A2, và làn xe 3, 4, 7, và 8 tham khảo vật trắng lớn với các kiểu gen A2A2 Một thụ coactivator hạt nhân tăng cường hoạt hóa phiên mã bằng cách tương tác với thụ thể hạt nhân liên kết với DNA. Các thụ hạt nhân bị ảnh hưởng, chẳng hạn như các thụ thể estrogen, thụ thể androgen, và thụ thể tuyến giáp, đóng vai trò quan trọng trong nhiều loại sinh vật kỳ họp 08. Sinh sản Truyền N ° 08-26 Phiên bản thử nghiệm chuyển đổi chỉ có 3 trang. Đánh giá chỉ. Chuyển Đổi bởi First PDF. (Phiên bản được cấp phép không hiển thị thông báo này!) Nhấn vào đây để có được giấy phép cho First PDF.

















































































đang được dịch, vui lòng đợi..
 
Các ngôn ngữ khác
Hỗ trợ công cụ dịch thuật: Albania, Amharic, Anh, Armenia, Azerbaijan, Ba Lan, Ba Tư, Bantu, Basque, Belarus, Bengal, Bosnia, Bulgaria, Bồ Đào Nha, Catalan, Cebuano, Chichewa, Corsi, Creole (Haiti), Croatia, Do Thái, Estonia, Filipino, Frisia, Gael Scotland, Galicia, George, Gujarat, Hausa, Hawaii, Hindi, Hmong, Hungary, Hy Lạp, Hà Lan, Hà Lan (Nam Phi), Hàn, Iceland, Igbo, Ireland, Java, Kannada, Kazakh, Khmer, Kinyarwanda, Klingon, Kurd, Kyrgyz, Latinh, Latvia, Litva, Luxembourg, Lào, Macedonia, Malagasy, Malayalam, Malta, Maori, Marathi, Myanmar, Mã Lai, Mông Cổ, Na Uy, Nepal, Nga, Nhật, Odia (Oriya), Pashto, Pháp, Phát hiện ngôn ngữ, Phần Lan, Punjab, Quốc tế ngữ, Rumani, Samoa, Serbia, Sesotho, Shona, Sindhi, Sinhala, Slovak, Slovenia, Somali, Sunda, Swahili, Séc, Tajik, Tamil, Tatar, Telugu, Thái, Thổ Nhĩ Kỳ, Thụy Điển, Tiếng Indonesia, Tiếng Ý, Trung, Trung (Phồn thể), Turkmen, Tây Ban Nha, Ukraina, Urdu, Uyghur, Uzbek, Việt, Xứ Wales, Yiddish, Yoruba, Zulu, Đan Mạch, Đức, Ả Rập, dịch ngôn ngữ.

Copyright ©2025 I Love Translation. All reserved.

E-mail: