Preparation of bee samples for RT-P

Preparation of bee samples for RT-PCR and AGID tests
Ten bee heads were crushed in a mortar at 4 oC in 0.5 ml of 0.2M potassium



phosphate buffer, pH 7.5. Half of these crude preparations were used directly in AGID tests as previously described (Ribière et al., 2000). The other part was cleared at 12 000 g for 20 minutes and 200 µl of the supernatant was subjected to RNA extraction in the purification kit “High Pure Viral RNA Kit” (Roche, Meylan, France). Positive control samples were realised with experimentally-infected bee extracts, and negative controls with ex- traction buffer only. After extraction, RNA purification was assessed by spectro- photometry at 260 nm and 280 nm.


RT-PCR test

Reverse transcription of RNAs was performed using M-MLV reverse transcrip- tase (Clontech, Ozyme, France). First strand cDNA synthesis was performed for 1 h at 42 oC in reverse transcriptase buffer (50 mM Tris HCl pH 8.3, 75 mM KCl, 3 mM MgCl2), 0.5 mM dNTP’s, 20 pmol of random hexamer primers, 200 U of M- MLV reverse transcriptase and 10 l of ex- tracted RNA, in a total volume of 20 l. Amplification by PCR was performed us- ing two primers designed from the se- quence of the putative viral RNA polymerase gene of the CBPV (unpub- l i shed data, GenBank reference [AF375659] http://www.ncbi.nlm.nih.gov/ Genbank/index.html). The primers used, CBPV1: AGTTGTCATGGTTAACAGGA TACGAG and CBPV2: TCTAATCTTAGC
ACGAAAGCCGAG, amplify a 455 bp product. PCR was carried out in buffer (Platinum, Life technologies, Gibco BRL®, Cergy Pontoise, France): 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2 ,
0.2 mM dNTP’s, 0.2 M of each primer,
2.5 units of Platinum® Taq DNA Polymer- ase (Life technologies, GIBCO BRL®), and 5 l of cDNA in a total volume reaction of 50 l. The substrate cDNA was denatured for 2 min at 95 oC and thereafter 30 amplifi- cation cycles were carried out using the fol-

lowing programme: denaturation at 95 oC for 1 min, annealing at 55 oC for 30 s, exten- sion at 72 oC for 1 min, and 5 min at 72 oC after the last cycle. Following amplifica- tion, 8 l of PCR products were loaded with 2 l of loading buffer (0.25% bromophenol blue, 30% glycerol), in 1.5% agarose gel in TBE buffer (90 mM Tris, 90 mM boric acid, 2 mM EDTA, pH 8.3). Gel separation results were analysed with the program computer “Bio profil” (Vilber Lourmat, Marne La Vallée, France).

We assessed the specificity of the de- scribed RT-PCR by several methods. CBPV primers were compared to the refer- ence honey bee virus sequences available in the GenBank database using the ALIGN program (FASTA program version 2.0,
Pearson & University of Virginia, USA). The first seven PCR products ob- tained and two PCR products from hive without clinical symptoms were sequenced (Qiagen, Hilden, Germany). The nucleo- tide and deduced amino acid sequences were submitted to the GenBank database under accession numbers [AF461053] to [AF461061] (http: //www.ncbi.nlm.nih.gov/ Genbank/index.html). They were aligned and compared to the reference CBPV strain [AF375659] and to the honey bee virus se- quences available in the GenBank database using the ALIGN program (Myers and Miller, 1988; Huang and Miller, 1991) and verified by visual inspection. In the absence of clinical symptoms, detection was vali- dated in ten field samples by Southern blot- ting (Sambrook et al., 1989). PCR product of 455 pb from our reference CBPV strain was used as probe at the concentration of 10 ng/ml in hybridization buffer. Hybrid- ization was carried out at 55 oC overnight in an hybridization oven (Stuart Scientific, Surrey, UK). Labelling and detection were performed with the “AlkPhos direct label- ling and detection” and the “CDP star de- tection reagent” (gene image™, Amersham pharmacia biotech, Slough, UK). To determine its sensitivity, the RT-PCR test



was applied to 10-fold serial dilutions of several samples of 10 experimentally-in- fected bees. This experiment was repeated two other times on new bee extracts.


Comparison of diagnostic tests

Using clinical observation and experi- mental infection we selected two asymp- tomatic and one symptomatic hives. Performance characteristics of the three tests (experimental infection, AGID and RT-PCR) were compared in samples before and after experimental infection. Charac- teristic samples were selected for AGID and RT-PCR tests 13 days after experimen- tal inoculation.

Kết quả (Việt) 1:

Chuẩn bị của ong mẫu để thử nghiệm RT-Đảng Cộng sản Romania và AGIDMười ong đầu được nghiền nát trong một vữa lúc 4 oC trong cách 0.5 ml cách 0.2M kali bộ đệm phosphat, pH 7,5. Một nửa của các chế phẩm dầu thô được sử dụng trực tiếp trong bài kiểm tra AGID như đã mô tả (Ribière và ctv., 2000). Các phần khác đã được xóa 12 000 g trong 20 phút và 200 ml của supernatant phải chịu sự khai thác RNA trong bộ lọc "Cao tinh khiết virus RNA Kit" (Roche, Meylan, Pháp). Tích cực điều khiển mẫu đã được thực hiện với chất chiết xuất từ thử nghiệm nhiễm ong, và tiêu cực điều khiển với lực kéo cũ bộ đệm chỉ. Sau khi khai thác, RNA thanh lọc được đánh giá bởi spectro-trắc quang tại 260 nm và 280 nm. Đảng Cộng sản Romania RT thử nghiệmPhiên mã ngược Rnas và Bắc Ireland được thực hiện bằng cách sử dụng M-MLV đảo ngược transcrip-tase (Clontech, Ozyme, Pháp). Đầu tiên strand cDNA tổng hợp được thực hiện cho 1 h 42 oC trong ngược bộ đệm (50 mM Tris HCl pH 8.3, 75 mM KCl, 3 mM MgCl2), 0,5 mM dNTP, 20 pmol của chất nền, mồi ngẫu nhiên hexamer, 200 U của M - MLV reverse transcriptase và 10 l ex - tracted RNA, trong tổng diện tích 20 l. Các khuếch đại bởi PCR là thực hiện với chúng tôi-ing hai chất nền, mồi được thiết kế từ quence se gen giả định virus ARN polymerase của CBPV (unpub-l tôi kho dữ liệu, GenBank tham khảo [AF375659] http://www.ncbi.nlm.nih.gov/ Genbank/index.html). Chất mồi được sử dụng, CBPV1: AGTTGTCATGGTTAACAGGA TACGAG và CBPV2: TCTAATCTTAGCACGAAAGCCGAG, amplify a 455 bp product. PCR was carried out in buffer (Platinum, Life technologies, Gibco BRL®, Cergy Pontoise, France): 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2 ,0.2 mM dNTP’s, 0.2 M of each primer,2.5 units of Platinum® Taq DNA Polymer- ase (Life technologies, GIBCO BRL®), and 5 l of cDNA in a total volume reaction of 50 l. The substrate cDNA was denatured for 2 min at 95 oC and thereafter 30 amplifi- cation cycles were carried out using the fol- lowing programme: denaturation at 95 oC for 1 min, annealing at 55 oC for 30 s, exten- sion at 72 oC for 1 min, and 5 min at 72 oC after the last cycle. Following amplifica- tion, 8 l of PCR products were loaded with 2 l of loading buffer (0.25% bromophenol blue, 30% glycerol), in 1.5% agarose gel in TBE buffer (90 mM Tris, 90 mM boric acid, 2 mM EDTA, pH 8.3). Gel separation results were analysed with the program computer “Bio profil” (Vilber Lourmat, Marne La Vallée, France).We assessed the specificity of the de- scribed RT-PCR by several methods. CBPV primers were compared to the refer- ence honey bee virus sequences available in the GenBank database using the ALIGN program (FASTA program version 2.0, Pearson & University of Virginia, USA). The first seven PCR products ob- tained and two PCR products from hive without clinical symptoms were sequenced (Qiagen, Hilden, Germany). The nucleo- tide and deduced amino acid sequences were submitted to the GenBank database under accession numbers [AF461053] to [AF461061] (http: //www.ncbi.nlm.nih.gov/ Genbank/index.html). They were aligned and compared to the reference CBPV strain [AF375659] and to the honey bee virus se- quences available in the GenBank database using the ALIGN program (Myers and Miller, 1988; Huang and Miller, 1991) and verified by visual inspection. In the absence of clinical symptoms, detection was vali- dated in ten field samples by Southern blot- ting (Sambrook et al., 1989). PCR product of 455 pb from our reference CBPV strain was used as probe at the concentration of 10 ng/ml in hybridization buffer. Hybrid- ization was carried out at 55 oC overnight in an hybridization oven (Stuart Scientific, Surrey, UK). Labelling and detection were performed with the “AlkPhos direct label- ling and detection” and the “CDP star de- tection reagent” (gene image™, Amersham pharmacia biotech, Slough, UK). To determine its sensitivity, the RT-PCR test


was applied to 10-fold serial dilutions of several samples of 10 experimentally-in- fected bees. This experiment was repeated two other times on new bee extracts.


Comparison of diagnostic tests

Using clinical observation and experi- mental infection we selected two asymp- tomatic and one symptomatic hives. Performance characteristics of the three tests (experimental infection, AGID and RT-PCR) were compared in samples before and after experimental infection. Charac- teristic samples were selected for AGID and RT-PCR tests 13 days after experimen- tal inoculation.

Kết quả (Việt) 2:

Chuẩn bị mẫu ong cho RT-PCR và AGID kiểm tra
Ten đầu ong đã bị nghiền nát trong cối ở 4 oC trong 0,5 ml 0.2m potassium phosphate buffer, pH 7,5. Một nửa của các chế phẩm thô được sử dụng trực tiếp trong các thử nghiệm AGID như mô tả trước đây (Ribière et al., 2000). Các phần khác đã được thông quan tại 12 000 g cho 20 phút và 200 ml của các nổi đã phải chịu chiết RNA trong bộ lọc "High tinh khiết Viral RNA Kit" (Roche, Meylan, Pháp). Các mẫu đối chứng dương tính được thực hiện với chất chiết xuất từ ong nghiệm nhiễm, và điều khiển âm với Ex- lực kéo chỉ đệm. Sau khi khai thác, lọc RNA được đánh giá bằng trắc quang quang phổ ở 260 nm và 280 nm. Xét nghiệm RT-PCR Xếp phiên mã của RNA được thực hiện bằng cách sử dụng M-MLV đảo ngược transcrip- tase (Clontech, Ozyme, Pháp). Tổng hợp sợi cDNA đầu tiên đã được thực hiện trong 1 giờ ở 42 oC trong ngược đệm transcriptase (50 mM Tris HCl pH 8.3, 75 mM KCl, 3 mM MgCl2), 0,5 mM dNTP sẽ nhân, 20 pmol của mồi hexame ngẫu nhiên, 200 U của M- MLV sao chép ngược và 10 l của Ex- RNA hút được, trong tổng khối lượng 20 l. Khuếch đại bằng PCR được thực hiện chúng tôi- ing hai cặp mồi được thiết kế từ các sequence se- của virus gen RNA polymerase giả định của các CBPV (li unpub- đổ dữ liệu, GenBank tham khảo [AF375659] http: //www.ncbi.nlm.nih. gov / GenBank / index.html). Các mồi được sử dụng, CBPV1: AGTTGTCATGGTTAACAGGA TACGAG và CBPV2: TCTAATCTTAGC ACGAAAGCCGAG, khoa trương một sản phẩm 455 bp. PCR được thực hiện trong bộ đệm (Platinum, công nghệ Life, Gibco BRL®, Cergy Pontoise, Pháp): 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1,5 mM MgCl2, 0,2 mM dNTP sẽ nhân, 0,2 M của mỗi lớp sơn lót, 2.5 đơn vị của Platinum® Taq DNA Polymer- ase (công nghệ Life, Gibco BRL®), và 5 l của cDNA trong tổng phản ứng khối lượng của 50 l. Các cDNA chất nền đã được biến tính cho 2 phút ở 95 oC và sau 30 chu kỳ cation khuyếch được thực hiện bằng cách sử dụng fol chương trình rống: biến tính ở 95 oC trong 1 phút, ủ ở 55 oC trong 30 s, sion mở rộng cho ở 72 oC trong 1 phút, và 5 phút ở 72 oC sau khi chu kỳ cuối cùng. Sau tion amplifica-, 8 l của sản phẩm PCR đã được nạp với 2 l bốc đệm (0,25% bromophenol màu xanh, 30% glycerol), ở 1,5% gel agarose trong TBE đệm (90 mM Tris, 90 mM boric acid, 2 mM EDTA, pH 8,3). Kết quả tách gel được phân tích với các máy tính chương trình "Bio profil" (Vilber Lourmat, Marne La Vallée, Pháp). Chúng tôi đánh giá các đặc trưng của de- tả RT-PCR bằng nhiều phương pháp. CBPV mồi được so sánh với các refer- khoa mật ong rút ong trình tự có sẵn trong cơ sở dữ liệu GenBank sử dụng chương trình ALIGN (chương trình FASTA phiên bản 2.0, Pearson & Đại học Virginia, Hoa Kỳ). Bảy sản phẩm PCR lần đầu tiên quan sát trì và hai sản phẩm PCR từ tổ không có triệu chứng lâm sàng đã được lập trình tự (Qiagen, Hilden, Đức). Các triều nucleotide và trình tự axit amin suy luận đã được trình lên cơ sở dữ liệu GenBank dưới con số nhập [AF461053] để [AF461061] (http: //www.ncbi.nlm.nih.gov/ GenBank / index.html). Họ đã liên kết và so sánh với các tài liệu tham khảo CBPV chủng [AF375659] và virus ong mật ong hậu se- có sẵn trong cơ sở dữ liệu GenBank sử dụng chương trình ALIGN (Myers và Miller, 1988; Huang và Miller, 1991) và được xác nhận qua sự kiểm tra trực quan. Trong trường hợp không có triệu chứng lâm sàng, phát hiện được vali- ngày trong mười mẫu ruộng do Southern blot- ting (Sambrook et al., 1989). Sản phẩm PCR của 455 pb từ tài liệu tham khảo CBPV căng thẳng của chúng tôi đã được sử dụng như thăm dò ở nồng độ 10 ng / ml trong lai đệm. Hóa Hybrid- được tiến hành ở 55 oC qua đêm trong lò lai (Stuart khoa học, Surrey, Anh). Dán nhãn và phát hiện được thực hiện với "AlkPhos label- trực tiếp ling và phát hiện" và "ngôi sao CDP triển sự bảo thuốc thử" (gene ảnh ™, Amersham Pharmacia công nghệ sinh học, Slough, Vương quốc Anh). Để xác định độ nhạy của nó, các xét nghiệm RT-PCR được áp dụng cho 10 lần pha loãng nối tiếp của một số mẫu của 10 con ong dịch sàng thực nghiệm-tư. Thí nghiệm này được lặp đi lặp lại hai lần khác vào chất chiết xuất từ ong mới. So sánh các xét nghiệm chẩn đoán dùng quan sát lâm sàng và bệnh tâm thần nghiệm chúng tôi chọn hai Tomatic asymp- và một phát ban có triệu chứng. Đặc điểm hoạt động của ba bài kiểm tra (nhiễm thực nghiệm, AGID và RT-PCR) được so sánh trong các mẫu trước và sau khi gây nhiễm thực nghiệm. Mẫu teristic charac đã được lựa chọn cho AGID và RT-PCR kiểm tra 13 ngày sau khi thực nghiệm tiêm tal.