Preparation of bee samples for RT-P

Preparation of bee samples for RT-PCR and AGID tests
Ten bee heads were crushed in a mortar at 4 oC in 0.5 ml of 0.2M potassium



phosphate buffer, pH 7.5. Half of these crude preparations were used directly in AGID tests as previously described (Ribière et al., 2000). The other part was cleared at 12 000 g for 20 minutes and 200 µl of the supernatant was subjected to RNA extraction in the purification kit “High Pure Viral RNA Kit” (Roche, Meylan, France). Positive control samples were realised with experimentally-infected bee extracts, and negative controls with ex- traction buffer only. After extraction, RNA purification was assessed by spectro- photometry at 260 nm and 280 nm.


RT-PCR test

Reverse transcription of RNAs was performed using M-MLV reverse transcrip- tase (Clontech, Ozyme, France). First strand cDNA synthesis was performed for 1 h at 42 oC in reverse transcriptase buffer (50 mM Tris HCl pH 8.3, 75 mM KCl, 3 mM MgCl2), 0.5 mM dNTP’s, 20 pmol of random hexamer primers, 200 U of M- MLV reverse transcriptase and 10 l of ex- tracted RNA, in a total volume of 20 l. Amplification by PCR was performed us- ing two primers designed from the se- quence of the putative viral RNA polymerase gene of the CBPV (unpub- l i shed data, GenBank reference [AF375659] http://www.ncbi.nlm.nih.gov/ Genbank/index.html). The primers used, CBPV1: AGTTGTCATGGTTAACAGGA TACGAG and CBPV2: TCTAATCTTAGC
ACGAAAGCCGAG, amplify a 455 bp product. PCR was carried out in buffer (Platinum, Life technologies, Gibco BRL®, Cergy Pontoise, France): 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2 ,
0.2 mM dNTP’s, 0.2 M of each primer,
2.5 units of Platinum® Taq DNA Polymer- ase (Life technologies, GIBCO BRL®), and 5 l of cDNA in a total volume reaction of 50 l. The substrate cDNA was denatured for 2 min at 95 oC and thereafter 30 amplifi- cation cycles were carried out using the fol-

lowing programme: denaturation at 95 oC for 1 min, annealing at 55 oC for 30 s, exten- sion at 72 oC for 1 min, and 5 min at 72 oC after the last cycle. Following amplifica- tion, 8 l of PCR products were loaded with 2 l of loading buffer (0.25% bromophenol blue, 30% glycerol), in 1.5% agarose gel in TBE buffer (90 mM Tris, 90 mM boric acid, 2 mM EDTA, pH 8.3). Gel separation results were analysed with the program computer “Bio profil” (Vilber Lourmat, Marne La Vallée, France).

We assessed the specificity of the de- scribed RT-PCR by several methods. CBPV primers were compared to the refer- ence honey bee virus sequences available in the GenBank database using the ALIGN program (FASTA program version 2.0,
Pearson & University of Virginia, USA). The first seven PCR products ob- tained and two PCR products from hive without clinical symptoms were sequenced (Qiagen, Hilden, Germany). The nucleo- tide and deduced amino acid sequences were submitted to the GenBank database under accession numbers [AF461053] to [AF461061] (http: //www.ncbi.nlm.nih.gov/ Genbank/index.html). They were aligned and compared to the reference CBPV strain [AF375659] and to the honey bee virus se- quences available in the GenBank database using the ALIGN program (Myers and Miller, 1988; Huang and Miller, 1991) and verified by visual inspection. In the absence of clinical symptoms, detection was vali- dated in ten field samples by Southern blot- ting (Sambrook et al., 1989). PCR product of 455 pb from our reference CBPV strain was used as probe at the concentration of 10 ng/ml in hybridization buffer. Hybrid- ization was carried out at 55 oC overnight in an hybridization oven (Stuart Scientific, Surrey, UK). Labelling and detection were performed with the “AlkPhos direct label- ling and detection” and the “CDP star de- tection reagent” (gene image™, Amersham pharmacia biotech, Slough, UK). To determine its sensitivity, the RT-PCR test



was applied to 10-fold serial dilutions of several samples of 10 experimentally-in- fected bees. This experiment was repeated two other times on new bee extracts.


Comparison of diagnostic tests

Using clinical observation and experi- mental infection we selected two asymp- tomatic and one symptomatic hives. Performance characteristics of the three tests (experimental infection, AGID and RT-PCR) were compared in samples before and after experimental infection. Charac- teristic samples were selected for AGID and RT-PCR tests 13 days after experimen- tal inoculation.


Observations in an experimental apiary

Two samples of apparently healthy bees were taken from inside each of thirty three colonies (66 total) from our laboratory api- ary on 11 July and 25 October 2000. They were immediately frozen at –20 oC before analysis by RT-PCR and AGID tests.
During July and August, colonies were sampled when abnormal mortality and signs evoking chronic paralysis occurred. Dead bees and bees trembling at the en- trance of the hive were sampled separately. During this period, bees standing in front of the hives were sampled at least once in all colonies. These samples were analysed by AGID for CBPV diagnosis only. After these two months, colony activity was less intense and the last sample was taken on 25 October to assess the status of the hives before winter.
Colonies were treated for Varroa destructor using Amitraz strips (Apivar®, Biové, France) in April, and surveyed monthly for this parasite until the end of October. Each brood frame was visually in- spected to detect Varroa destructor on bees and cells, and bees with associated symp-

toms such as deformed wings (DeJong et al., 1982; BowenWalker et al., 1999). Screening for nosemosis, amœba and acariosis diseases was also conducted on the 66 samples of apparently healthy bees according to previously described diagnos- tic methods (O.I.E, 1996). For nosemosis and amoeba diseases diagnosis, 20 bee ab- domens from each colony were homogen- ised in 2 ml of distilled water and the preparation was examined microscopically at ×400 magnification (Steche and Ruijter, 1996). For diagnosis of Acarapis woodi, 20 bee thoraces were homogenised in 20 ml of distilled water. After filtration and centrifugation the deposit was treated with undiluted lactic acid than examined micro- scopically at ×100 magnification (Ritter, 1996). Results were compared using the Fisher exact test (Zar, 1974).

Kết quả (Việt) 2:

Chuẩn bị mẫu ong cho RT-PCR và AGID kiểm tra
Ten đầu ong đã bị nghiền nát trong cối ở 4 oC trong 0,5 ml 0.2m potassium phosphate buffer, pH 7,5. Một nửa của các chế phẩm thô được sử dụng trực tiếp trong các thử nghiệm AGID như mô tả trước đây (Ribière et al., 2000). Các phần khác đã được thông quan tại 12 000 g cho 20 phút và 200 ml của các nổi đã phải chịu chiết RNA trong bộ lọc "High tinh khiết Viral RNA Kit" (Roche, Meylan, Pháp). Các mẫu đối chứng dương tính được thực hiện với chất chiết xuất từ ong nghiệm nhiễm, và điều khiển âm với Ex- lực kéo chỉ đệm. Sau khi khai thác, lọc RNA được đánh giá bằng trắc quang quang phổ ở 260 nm và 280 nm. Xét nghiệm RT-PCR Xếp phiên mã của RNA được thực hiện bằng cách sử dụng M-MLV đảo ngược transcrip- tase (Clontech, Ozyme, Pháp). Tổng hợp sợi cDNA đầu tiên đã được thực hiện trong 1 giờ ở 42 oC trong ngược đệm transcriptase (50 mM Tris HCl pH 8.3, 75 mM KCl, 3 mM MgCl2), 0,5 mM dNTP sẽ nhân, 20 pmol của mồi hexame ngẫu nhiên, 200 U của M- MLV sao chép ngược và 10 l của Ex- RNA hút được, trong tổng khối lượng 20 l. Khuếch đại bằng PCR được thực hiện chúng tôi- ing hai cặp mồi được thiết kế từ các sequence se- của virus gen RNA polymerase giả định của các CBPV (li unpub- đổ dữ liệu, GenBank tham khảo [AF375659] http: //www.ncbi.nlm.nih. gov / GenBank / index.html). Các mồi được sử dụng, CBPV1: AGTTGTCATGGTTAACAGGA TACGAG và CBPV2: TCTAATCTTAGC ACGAAAGCCGAG, khoa trương một sản phẩm 455 bp. PCR được thực hiện trong bộ đệm (Platinum, công nghệ Life, Gibco BRL®, Cergy Pontoise, Pháp): 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1,5 mM MgCl2, 0,2 mM dNTP sẽ nhân, 0,2 M của mỗi lớp sơn lót, 2.5 đơn vị của Platinum® Taq DNA Polymer- ase (công nghệ Life, Gibco BRL®), và 5 l của cDNA trong tổng phản ứng khối lượng của 50 l. Các cDNA chất nền đã được biến tính cho 2 phút ở 95 oC và sau 30 chu kỳ cation khuyếch được thực hiện bằng cách sử dụng fol chương trình rống: biến tính ở 95 oC trong 1 phút, ủ ở 55 oC trong 30 s, sion mở rộng cho ở 72 oC trong 1 phút, và 5 phút ở 72 oC sau khi chu kỳ cuối cùng. Sau tion amplifica-, 8 l của sản phẩm PCR đã được nạp với 2 l bốc đệm (0,25% bromophenol màu xanh, 30% glycerol), ở 1,5% gel agarose trong TBE đệm (90 mM Tris, 90 mM boric acid, 2 mM EDTA, pH 8,3). Kết quả tách gel được phân tích với các máy tính chương trình "Bio profil" (Vilber Lourmat, Marne La Vallée, Pháp). Chúng tôi đánh giá các đặc trưng của de- tả RT-PCR bằng nhiều phương pháp. CBPV mồi được so sánh với các refer- khoa mật ong rút ong trình tự có sẵn trong cơ sở dữ liệu GenBank sử dụng chương trình ALIGN (chương trình FASTA phiên bản 2.0, Pearson & Đại học Virginia, Hoa Kỳ). Bảy sản phẩm PCR lần đầu tiên quan sát trì và hai sản phẩm PCR từ tổ không có triệu chứng lâm sàng đã được lập trình tự (Qiagen, Hilden, Đức). Các triều nucleotide và trình tự axit amin suy luận đã được trình lên cơ sở dữ liệu GenBank dưới con số nhập [AF461053] để [AF461061] (http: //www.ncbi.nlm.nih.gov/ GenBank / index.html). Họ đã liên kết và so sánh với các tài liệu tham khảo CBPV chủng [AF375659] và virus ong mật ong hậu se- có sẵn trong cơ sở dữ liệu GenBank sử dụng chương trình ALIGN (Myers và Miller, 1988; Huang và Miller, 1991) và được xác nhận qua sự kiểm tra trực quan. Trong trường hợp không có triệu chứng lâm sàng, phát hiện được vali- ngày trong mười mẫu ruộng do Southern blot- ting (Sambrook et al., 1989). Sản phẩm PCR của 455 pb từ tài liệu tham khảo CBPV căng thẳng của chúng tôi đã được sử dụng như thăm dò ở nồng độ 10 ng / ml trong lai đệm. Hóa Hybrid- được tiến hành ở 55 oC qua đêm trong lò lai (Stuart khoa học, Surrey, Anh). Dán nhãn và phát hiện được thực hiện với "AlkPhos label- trực tiếp ling và phát hiện" và "ngôi sao CDP triển sự bảo thuốc thử" (gene ảnh ™, Amersham Pharmacia công nghệ sinh học, Slough, Vương quốc Anh). Để xác định độ nhạy của nó, các xét nghiệm RT-PCR được áp dụng cho 10 lần pha loãng nối tiếp của một số mẫu của 10 con ong dịch sàng thực nghiệm-tư. Thí nghiệm này được lặp đi lặp lại hai lần khác vào chất chiết xuất từ ong mới. So sánh các xét nghiệm chẩn đoán dùng quan sát lâm sàng và bệnh tâm thần nghiệm chúng tôi chọn hai Tomatic asymp- và một phát ban có triệu chứng. Đặc điểm hoạt động của ba bài kiểm tra (nhiễm thực nghiệm, AGID và RT-PCR) được so sánh trong các mẫu trước và sau khi gây nhiễm thực nghiệm. Mẫu teristic charac đã được lựa chọn cho AGID và RT-PCR kiểm tra 13 ngày sau khi thực nghiệm tiêm tal. Quan sát tại một nhà nuôi ong nghiệm Hai mẫu con ong khỏe mạnh được lấy từ bên trong mỗi người ba mươi ba thuộc địa (tổng số 66) từ api- phòng thí nghiệm của chúng tôi ary vào ngày 11 tháng 7 và 25 tháng 10 năm 2000. Họ đã ngay lập tức đông lạnh ở -20 oC trước khi phân tích bằng RT-PCR và AGID kiểm tra. Trong tháng bảy và tháng tám, các thuộc địa đã được lấy mẫu khi tử vong bất thường và dấu hiệu gợi liệt mãn tính xảy ra. Ong chết và ong run rẩy ở trance en- của tổ ong được lấy mẫu một cách riêng biệt. Trong thời gian này, những con ong đang đứng ở phía trước của các tổ ong được lấy mẫu ít nhất một lần trong tất cả các thuộc địa. Các mẫu được phân tích bởi AGID để chẩn đoán CBPV chỉ. Sau hai tháng này, hoạt động của đàn kiến là ít căng thẳng và các mẫu mới nhất được chụp vào 25 tháng 10 để đánh giá tình trạng của các tổ ong trước khi mùa đông. Colonies đã được điều trị Varroa destructor sử dụng Amitraz dải (Apivar®, Biové, Pháp) vào tháng Tư, và khảo sát hàng tháng cho ký sinh trùng này cho đến cuối tháng Mười. Mỗi khung bố mẹ được trực quan trong- spected để phát hiện Varroa destructor vào ong và các tế bào, và ong với chứng liên Toms như cánh bị biến dạng (DeJong et al, 1982;.. BowenWalker et al, 1999). Tầm soát bệnh nosemosis, amip và acariosis cũng được tiến hành trên 66 mẫu của các con ong khỏe mạnh theo mô tả trước đây diagnos- phương pháp tic (OIE, 1996). Đối với nosemosis và amip bệnh chẩn đoán, 20 ong domens AB- từ mỗi đàn đã homogen- ised trong 2 ml nước cất và việc chuẩn bị đã được kiểm tra dưới kính hiển vi ở độ phóng đại × 400 (Steche và Ruijter, 1996). Để chẩn đoán của Acarapis woodi, 20 thoraces ong được đồng nhất trong 20 ml nước cất. Sau khi lọc và ly tâm các khoản tiền gửi được điều trị bằng axit lactic không bị pha loãng hơn kiểm tra vi scopically ở × 100 phóng đại (Ritter, 1996). Kết quả được so sánh bằng test chính xác Fisher (Zar, 1974).