JOURNAL OF BIOSCIENCE AND BIOENGINE

JOURNAL OF BIOSCIENCE AND BIOENGINEERING
Vol. 98, No. 1, 20–27. 2004
Succession of a Microbial Community during Stable Operation
of a Semi-continuous Garbage-Decomposing System
SHIN HARUTA,1 MIE KONDO,1 KOHEI NAKAMURA,1 CHAUNJIT CHANCHITPRICHA,1
HIROSHI AIBA,1 MASAHARU ISHII,1 AND YASUO IGARASHI1
*
Graduate School of Agricultural and Life Sciences, The University of Tokyo,
1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan1
Received 22 December 2003/Accepted 12 April 2004
The microbial community in a garbage-decomposing system was analyzed using denaturing
gradient gel electrophoresis (DGGE) on the basis of 16S rDNA. The system treated 1 kg of garbage
everyday for two months at ambient temperature with almost constant decomposition efficiency,
although a transient pH increase occurred. Succession of the banding pattern of the
DGGE profile suggested that the bacterial community was not directly affected by the continuous
addition of non-sterilized garbage into the open system, but changed with the fluctuation of pH.
These resistance and resilience characteristics of the community structure may be effective to
keep the decomposition efficiency stable. The analyses of the DNA sequences from the DGGE
bands suggested the existence of uncultured or novel bacteria as well as Lactobacillus sp., Corynebacterium
spp., Enterococcus spp., and Staphylococcus sp. A specific PCR detection was performed
to evaluate the existence of Escherichia coli within the community. E. coli 16S rDNAs were
not detected from the decomposing system.
[Key words: microbial community, garbage, denaturing gradient gel electrophoresis]
The increasing amount of household garbage induces several
environmental burdens, particularly in urban areas, such
as the evolution of harmful gases from the incineration of
garbage with high moisture content, limited space for landfill,
and the amount of energy that is required for the collection
of wastes from each family for field-scale composting.
Therefore, on-site treatment is desirable to reduce the amount
of household garbage.
A garbage-decomposing system should be able to treat
approximately 1 kg of kitchen garbage produced by each
family everyday. Several types of equipment are commercially
available for daily decomposition. A popular system
is equipped with an air draft and stirring wings to dry and
mix garbage electrically, and some systems have a heating
module and/or a deodorizing device. Under certain conditions,
the temperature increases to approximately 60
C without
the heater and the pH increases to 8–9 to produce an
ammoniacal smell (1). In practice, however, it is difficult to
maintain the temperature (>60
C) high enough to eliminate
pathogenic bacteria such as Escherichia coli. Therefore,
these systems are generally operated at ambient temperature
(2). However, few studies have reported on the microbial
community in these systems.
Non-sterilized substrates are continuously supplied into
these systems as well as into bioreactors such as wastewater
treatment and biogas fermentation that are generally operated
in a continuous mode. The microbial communities in
these processes have not been well clarified, and the bioprocesses
occasionally get out of control. It is necessary to
determine how the microbial community succeeds to maintain
the function stably during operation in order to regulate
these bioprocesses. In the present study, we analyzed the microbial
community in a garbage-decomposing system during
a two-month operating period using a denaturing gradient
gel electrophoresis (DGGE) method. The existence of
E. coli as an indicator organism for public health was also
evaluated using a PCR detection method.
MATERIALS AND METHODS
Garbage-decomposing system A laboratory scale reactor stirred
garbage with stirring wings for 4 min at 30-min intervals (1).
The total volume was 30 l. The airflow rate was controlled at approximately
90 l per minute. The temperature was not controlled and
no additional bacteria were supplied. Sawdust (14 l, Biowogran;
Morishita Kikai, Wakayama) was added as a starting material to
provide an initial moisture content of approximately 50%. One kg
of the standardized garbage was added everyday. The composition
of the garbage was 36% vegetable (18% cabbage and 18% carrot),
30% fruit (16% banana and 14% apple), and 34% other organic
material (10% fried chicken, 10% dried fish, 10% boiled rice, and
4% used Japanese tea leaves). The garbage contained around 75–
78% moisture and had a pH value of 6–7.
The temperature, pH, moisture content, and weight of the materials
in the reactor were monitored. The moisture content was measured
with an electronic moisture balance (MOC-30S; Shimadzu,
Kyoto). The carbon-to-nitrogen (C/N, g/g) ratio was analyzed by
Japan Food Research Laboratories. The decomposition rate was
determined from the reduction in garbage weight. The total weight
* Corresponding author. e-mail: [e-mail]
phone: [phone] fax: [phone]
VOL. 98, 2004 MICROBIAL COMMUNITY WITHIN A GARBAGE-DECOMPOSER 21
just before the addition of garbage was measured at intervals of
3–11 d, and the decomposition rate (D; gram weight per day) was
calculated by the following equation:
D
(NT1K(T2 T1) NT2)/(T2 T1)
where NT1 and NT2 indicate the total weight (gram) on days T1 and
T2, respectively, and K is the weight of garbage supplied per day,
i.e., 1000 (g wet weight/d). In the same way, the decomposition
rate on a dry-weight basis was calculated using the dry weight of
the garbage and the decomposing materials determined from their
moisture contents. A total of 100–200 g of decomposing materials
were taken from four or more points 12–14 h after the addition of
garbage, cut into pieces of less than 5 mm in diameter, mixed together
in a tube, and used as samples (1).
Bacterial cell count Ten grams of a sample was homogenized
and dispersed in 60 ml of water by a Polytron® homogenizer
(Kinematica, Littau/Luzern, Switzerland) operated for 10 min at
about 15,000 rpm on ice. The number of bacteria in the samples
was determined by the plate count method (tryptic soy agar [Difco
Laboratories, Detroit, MI, USA], 37C) and by direct counting of
4,6-diamidino-2-phenylindole (DAPI)-stained cells under a fluorescence
microscope (1).
In order to detect bacterial cells which did not form a colony, a
piece of agar where no colony formed was excised from the agar
plates after cultivation. The agar piece was stained with SYBR®
Green I (Molecular Probes, Eugene, OR, USA) and observed using
fluorescence microscope.
DNA extraction The decomposing materials taken from
the system were homogenized in an extraction buffer (100 mM
Tris–HCl, pH 9.0, 40 mM EDTA) with the Polytron® homogenizer
(Kinematica) as described above. Direct DNA extraction was performed
by the benzyl chloride method (3). Nucleic acids were finally
precipitated with isopropanol and the pellets were resuspended
in TE buffer (10 mM Tris–HCl, pH 8.0, 1 mM EDTA).
The DNA was further purified using a Geneclean® spin kit
(BIO101; Carlsbad, CA, USA) for PCR-DGGE analysis. For E. coli
detection experiments, the extracted DNA from the decomposing
materials was treated with RNase, purified by the Geneclean® spin
kit (BIO101) followed by PEG precipitation (4). The concentration
of the purified DNA was determined spectrophotometrically.
PCR for DGGE analysis PCR was performed using
AmpliTaqGold™ according to the manufacturer’s instructions
(Perkin Elmer Japan, Applied Biosystems Division, Chiba). The
primers used for DGGE were the following: 357F-GC, 5-CGCC
CGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGC
CTACGGGAGGCAGCAG-3 (E. coli positions, 341 to 357), and
517R, 5-ATTACCGCGGCTGCTGG-3 (E. coli positions, 517 to
534) (5). The underlined sequence is a GC clamp. The temperature
cycle for PCR was described previously (1). The products were
examined by electrophoresis on 2% agarose gel before applying
them to DGGE.
DGGE Double gradient-DGGE was performed as described
previously (1) with the DCode™ system (Bio-Rad Laboratories,
Hercules, CA, USA). Six to 12% of the polyacrylamide gradient
was superimposed on a 15% to 50% denaturant gradient where
100% was defined as 7 M urea with 40% formamide. Gels were
stained with SYBR® Green I (Molecular Probes). The gel image
was recorded with a Gel Print TM 2000i (Genomic Solutions, Ann
Arbor, MI, USA) under UV illumination. The gel bands were excised
with a clean razor blade and DNA was recovered as described
previously (1).
Sequencing Sequencing reactions were carried out with a
BigDye™ kit (Perkin Elmer Japan, Applied Biosystems Division)
according to the manufacturer’s instructions. The sequencing primers
were 517R and 357F, the latter being 357F-GC without the GC
clamp. The products were then analyzed with an ABI Model 377
DNA sequencer (Perkin Elmer). To determine the closest known
relatives, the 16S rDNA sequences obtained were compared with
those from the Ribosomal Database Project (RDP) and DDBJ
using the RDP and BLAST programs. The 16S rDNA partial sequences
obtained in this study have been submitted to DDBJ as
follows: AB110648 to AB110655.
Fluorescence in situ hybridization (FISH) FISH was performed
under the conditions described previously (1) with a probe
which is specific to the domain bacteria (EUB338 5-TGAGGATG
CCCTCCGTCG-3) (6). The 5-terminus of the probe was labeled
with fluorescein isothiocyanate.
Detection of E. coli by PCR A pair of primers was reported
previously for specific detection of E. coli in soil (7). The primers
were modified to increase the specificity on the basis of the alignments
of 16S rDNA sequences (Tables 1 and 2): ECF73, 5-CA
GGAAGAAGCTTGCTTCTTTGC-3 (E. coli positions, 73 to 95)
(Table 1), and ECR476, 5-AGCAAAGGTATTAACTTTACTCC-
3 (E. coli positions, 476 to 454) (Table 2). Although the sequences
of ECF73 and ECR476 were found in Haemophilus parasuis and
Shigella spp., respectively, the combination of these primers would
achiev

Kết quả (Việt) 1:

TẠP CHÍ KHOA HỌC SINH HỌC VÀ BIOENGINEERINGVol. 98, số 1, 20-27. năm 2004Thừa kế của một cộng đồng vi sinh vật trong khi hoạt động ổn địnhmột hệ thống phân hủy rác bán liên tụcSHIN HARUTA, 1 MIE KONDO, 1 KOHEI NAKAMURA, 1 CHAUNJIT CHANCHITPRICHA, 1HIROSHI AIBA, 1 OSOEKAWA ISHII, 1, YASUO IGARASHI1*Trường đại học nông nghiệp công nghệ sinh học, đại học Tokyo,1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan1Nhận được 22 tháng mười hai 2003/chấp nhận ngày 12 tháng 4 năm 2004Cộng đồng vi sinh vật trong một hệ thống phân hủy rác được phân tích bằng cách sử dụng biến tínhgradient gel điện (DGGE) trên cơ sở 16 rDNA. Hệ thống điều trị 1 kg của ráchàng ngày cho hai tháng ở các nhiệt độ môi trường xung quanh với hiệu quả gần như liên tục phân hủy,mặc dù độ pH thoáng qua tăng xảy ra. Kế tiếp của các mô hình dải của cácDGGE hồ sơ đề nghị rằng cộng đồng vi khuẩn không trực tiếp bị ảnh hưởng bởi các liên tụcNgoài ra phòng không-thải rác thải vào hệ thống mở, nhưng thay đổi với sự biến động độ pH.Những kháng và khả năng đàn hồi đặc điểm của cấu trúc cộng đồng có thể được hiệu quả đểgiữ cho hiệu quả phân hủy khách sạn được ổn định. Phân tích các trình tự ADN từ DGGEBan nhạc đề nghị sự tồn tại của vi khuẩn uncultured hoặc tiểu thuyết cũng như Lactobacillus sp., Corynebacteriumspp., Enterococcus spp. và Staphylococcus sp. Một phát hiện PCR cụ thể được thực hiệnđể đánh giá sự tồn tại của Escherichia coli trong cộng đồng. E. coli 16 rDNAskhông tìm thấy từ hệ thống phân hủy.[Từ khóa: cộng đồng vi sinh vật, rác, biến tính gradient gel điện]Số lượng ngày càng tăng của rác hộ gia đình gây ra một sốmôi trường gánh, đặc biệt là ở khu vực đô thị, như vậynhư sự tiến triển của các chất khí độc hại từ thiêu ra tro củarác với nội dung độ ẩm cao, không gian hạn chế cho bãi rác,và số lượng năng lượng đó là cần thiết cho bộ sưu tậpchất thải từ mỗi gia đình cho lĩnh vực-quy mô phân compost.Do đó, điều trị ngay trong khuôn viên là mong muốn để giảm số lượngrác thải gia đình.Một hệ thống phân hủy rác có thể để điều trịkhoảng 1 kg rác thải nhà bếp sản xuất bởi mỗigia đình hàng ngày. Một số loại thiết bị có thương mạicó sẵn cho hàng ngày phân hủy. Một hệ thống phổ biếnđược trang bị với một dự thảo máy và khuấy cánh để khô vàtrộn rác bằng điện, và một số hệ thống có một hệ thống sưởiMô-đun và/hoặc một thiết bị deodorizing. Dưới điều kiện nhất định,nhiệt độ tăng lên đến khoảng 60 C mà không cólò sưởi và độ pH tăng lên đến 8-9 để sản xuất mộtammoniacal mùi (1). Trong thực tế, Tuy nhiên, nó là khó khăn đểduy trì nhiệt độ (> 60 C) cao, đủ để loại bỏvi khuẩn gây bệnh như Escherichia coli. Do đó,Các hệ thống này thường hoạt động ở nhiệt độ môi trường(2). Tuy nhiên, vài nghiên cứu đã thông báo trên các vi sinh vậtcộng đồng trong các hệ thống.Chất khử trùng phòng không được cung cấp liên tục vàoCác hệ thống này cũng như vào bioreactors chẳng hạn như xử lý nước thảiđiều trị và khí sinh học quá trình lên men thường hoạt độngtrong một chế độ liên tục. Những cộng đồng vi sinh vậtcác quá trình này đã không là tốt làm rõ, và các bioprocessesthỉnh thoảng nhận được ra khỏi kiểm soát. Nó là cần thiết đểxác định như thế nào cộng đồng vi sinh vật thành công để duy trìchức năng ổn định trong các hoạt động để điều chỉnhCác bioprocesses. Trong nghiên cứu hiện tại, chúng tôi phân tích các vi sinh vậtCác cộng đồng trong một hệ thống phân hủy rác trongmột khoảng thời gian hai tháng hoạt động bằng cách sử dụng một gradient denaturinggel điện (DGGE) phương pháp. Sự tồn tại củaE. coli là một sinh vật chỉ số cho y tế công cộng là cũngđánh giá bằng cách sử dụng một phương pháp phát hiện Đảng Cộng sản Romania.VẬT LIỆU VÀ PHƯƠNG PHÁPPhân hủy rác hệ thống A phòng thí nghiệm quy mô lò khuấyrác với khuấy cánh trong 4 phút 30-phút khoảng thời gian (1).Tổng khối lượng là 30 l. Tỷ lệ dòng khí được kiểm soát ở khoảng90 l / phút. Nhiệt độ không được kiểm soát vàkhông có vi khuẩn bổ sung được cung cấp. Mùn cưa gỗ (14 l, Biowogran;Morishita Kikai, Wakayama) được thêm vào như là một tài liệu bắt đầu đểcung cấp một độ ẩm ban đầu của khoảng 50%. Một kgrác thải tiêu chuẩn đã được bổ sung hàng ngày. Thành phầncủa thùng rác là 36% thực vật (bắp cải 18% và 18% cà rốt),trái cây 30% (16% chuối và 14% apple), và 34% khác hữu cơvật liệu (10% chiên gà, 10% khô cá, 10% luộc gạo, và4% sử dụng tiếng Nhật trà lá). Thùng rác chứa khoảng 75-78% độ ẩm và có một giá trị pH của 6-7.Nhiệt độ, độ pH, độ ẩm, và trọng lượng của các vật liệutrong lò phản ứng đã được theo dõi. Nội dung độ ẩm đã được đovới một sự cân bằng độ ẩm điện tử (bộ XD-30; Shimadzu,Kyoto). Tỷ lệ carbon-để-nitơ (C/N, g/g) được phân tíchPhòng thí nghiệm nghiên cứu thực phẩm Nhật bản. Tỷ lệ phân hủy làxác định từ việc giảm trọng lượng rác. Tổng trọng lượng* Tác giả tương ứng. thư điện tử: [e-mail]điện thoại: + 81-(0) 3-5841-5142 fax: + 81-(0) 3-5841-5272 ngườiVOL. 98, NĂM 2004 CỘNG ĐỒNG VI SINH VẬT TRONG VÒNG MỘT RÁC-DECOMPOSER 21ngay trước khi việc bổ sung các rác thải được đo theo chu kỳ của3-11 d, và tốc độ phân hủy (D; gam trọng lượng mỗi ngày)tính bằng phương trình sau đây:D (NT1K (T2 T1) NT2) /(T2 T1)nơi NT1 và NT2 cho thấy tổng trọng lượng (gram) ngày T1 vàT2, tương ứng, và K là trọng lượng của rác cung cấp mỗi ngày,tức là, 1000 (g ướt trọng lượng/d). Trong cùng một cách, sự phân hủytỷ lệ trên cơ sở giặt-trọng lượng đã được tính toán bằng cách sử dụng trọng lượng khô củathùng rác và các tài liệu phân hủy xác định từ của họnội dung độ ẩm. Tổng cộng 100-200 g của phân hủy tài liệuđã lấy từ bốn hoặc nhiều hơn nữa chỉ 12-14 h sau khi bổ sung củarác, cắt thành miếng nhỏ hơn 5 mm đường kính, pha trộn với nhautrong một ống, và sử dụng làm mẫu (1).Tế bào vi khuẩn count mười gam một mẫu homogenizedvà phân tán trong 60 ml nước bởi một homogenizer Polytron ®(Kinematica, Littau/Luzern, Thuỵ Sỹ) hoạt động trong 10 phút tạikhoảng 15.000 vòng/phút trên băng. Số lượng vi khuẩn trong các mẫuđã được xác định bằng phương pháp tính tấm (tryptic đậu nành agar [DifcoPhòng thí nghiệm, Detroit, MI, Mỹ], 37 C) và bằng cách đếm trực tiếp của4, 6-diamidino-2-phenylindole (DAPI)-màu tế bào dưới một huỳnh quangkính hiển vi (1).Để phát hiện tế bào vi khuẩn mà không tạo thành một thuộc địa, mộtmảnh thạch mà không có thuộc địa hình thành đã excised từ agartấm sau khi trồng. Các mảnh thạch được nhuộm màu với SYBR ®Màu xanh lá cây I (đầu dò phân tử, Eugene, OR, Hoa Kỳ) và quan sát bằng cách sử dụnghuỳnh quang kính hiển vi.Khai thác DNA phân hủy các vật liệu Lấy từHệ thống được homogenized trong một bộ đệm khai thác (100 mMTris–HCl, pH 9.0, 40 mM EDTA) với homogenizer Polytron ®(Kinematica) như mô tả ở trên. Trực tiếp DNA khai thác được thực hiệnbởi benzyl clorua phương pháp (3). Axít nucleic cuối cùngkết tủa với isopropanol và các viên đã được resuspendedở TE đệm (10 mM Tris-HCl, pH 8.0, 1 mM EDTA).DNA là thêm tinh khiết sử dụng một bộ quay Geneclean ®(BIO101; Carlsbad, CA, Hoa Kỳ) cho Đảng Cộng sản Romania-DGGE phân tích. Cho E. colithử nghiệm phát hiện, DNA chiết xuất từ các phân hủyvật liệu được điều trị với RNase, tinh chế bằng các spin Geneclean ®Kit (BIO101) theo sau PEG mưa (4). Nồng độADN tinh khiết được xác định spectrophotometrically.Đảng Cộng sản Romania cho phân tích DGGE Đảng Cộng sản Romania được thực hiện bằng cách sử dụngAmpliTaqGold ™ theo hướng dẫn của nhà sản xuất(Perkin Elmer Japan, ứng dụng Biosystems Division, Chiba). Cácchất nền, mồi được sử dụng cho DGGE là như sau: 357F-GC, 5 - CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG-3 (E. coli vị trí, 341 để 357), và517R, 5 - ATTACCGCGGCTGCTGG-3 (E. coli vị trí, 517 để534) (5). Trình tự gạch dưới là một kẹp GC. Nhiệt độchu kỳ cho Đảng Cộng sản Romania được mô tả trước đó (1). Các sản phẩmkiểm tra bởi điện trên 2% agarose gel trước khi áp dụnghọ DGGE.DGGE đôi gradient-DGGE đã được thực hiện như mô tảtrước đây (1) với hệ thống DCode ™ (phòng thí nghiệm sinh học-Rad,Hercules, CA, Hoa Kỳ). Sáu đến 12% của polyacrylamide gradientchồng vào một gradient denaturant 15% đến 50% nơi100% được định nghĩa là 7 M urê với 40% formamide. Gelmàu với SYBR ® xanh tôi (phân tử đầu dò). Hình ảnh gelđược thu âm với một Gel in TM 2000i (gen giải pháp, AnnArbor, MI, Mỹ) theo ánh sáng UV. Các ban nhạc gel đã excisedvới một lưỡi dao cạo sạch và DNA đã được thu hồi như được mô tảtrước đây (1).Trình tự trình tự phản ứng đã được thực hiện với mộtBigDye ™ kit (Perkin Elmer Nhật bản, áp dụng Biosystems Division)theo hướng dẫn của nhà sản xuất. Trình tự mồiđã là 517R và 357F, sau này là 357F-GC mà không có các GCkẹp. Các sản phẩm được phân tích sau đó với một mô hình ABI 377DNA sequencer (Perkin Elmer). Để xác định được biết đến gần nhấtngười thân, các chuỗi rDNA 16 thu được được so vớinhững người từ các dự án cơ sở dữ liệu ribosome (RDP) và DDBJsử dụng các chương trình RDP và vụ nổ. 16 rDNA một phần Chuỗithu được trong nghiên cứu này đã được gửi đến DDBJ nhưtheo: AB110648 để AB110655.Huỳnh quang trong situ lai ghép (cá) cá được thực hiệntheo các điều kiện được mô tả trước đó (1) với mộtđó là cụ thể cho các vi khuẩn miền (EUB338 5 - TGAGGATGCCCTCCGTCG-3) (6). Terminus 5 - các thăm dò đã được dán nhãnvới fluorescein isothiocyanate.Các phát hiện của E. coli bởi Đảng Cộng sản Romania A cặp của chất nền, mồi đã được báo cáotrước đó để cụ thể phát hiện của E. coli trong đất (7). Các chất nền, mồiđược cải tiến để tăng các đặc trưng trên cơ sở các sự sắp xếp16 rDNA trình tự (bảng 1 và 2): ECF73, 5 -CAGGAAGAAGCTTGCTTCTTTGC-3 (vị trí E. coli, 73 để 95)(Bảng 1), và ECR476, 5 - AGCAAAGGTATTAACTTTACTCC-3 (vị trí E. coli, 476 để 454) (bảng 2). Mặc dù các trình tựECF73 và ECR476 đã được tìm thấy ở Haemophilus parasuis vàShigella spp., tương ứng, sự kết hợp của các chất nền, mồi nàoachiev