Abstract – Kashmir bee virus (KBV)

Abstract – Kashmir bee virus (KBV) often persists in bees as a covert infection with no apparent symptoms.
The virus can switch to become an overt lethal infection, especially in the presence of Varroa mites.
Although the virus is distributed worldwide, it was thought to be absent from the UK. A real-time PCR
assay was developed for specific detection of KBV. No cross-reaction was observed with other bee viruses.
KBV was successfully amplified from different life stages of honey bees and from a wasp and bumble bee.
Using the real-time PCR assay, a survey of hives was conducted in England and Wales to investigate the
presence and geographical distribution of the virus. KBV was detected within three colonies at two locations.
The virus titre in the positive samples was quantified and found to contain similar levels to other bees
with covert KBV infection. We conclude that KBV is present in the UK and cannot now be considered an
exotic disease. The discovery of KBV in the UK has major significance for import policies.
Kashmir bee virus / Apis mellifera / real-time PCR / detection / survey
1. INTRODUCTION
Honeybee viruses have had a high pro-
file in recent years due to their association
with Varroa destructor Anderson and Trueman
in colony collapses (Allen and Ball, 1996;
Ball, 1997; Ball and Bailey, 1997; Nordström
et al., 1999; Martin, 2001; Bakonyi et al.,
2002; Sumpter and Martin, 2004) and in
risk analysis for third country imports under
the General Agreement on Tariffs and Trade
– World Trade Organisation (GATT-WTO)
sanitary and phytosanitary (SPS) agreements
(Brown, 1999; Wehling, 2000). Despite this,
many of the bee viruses have only recently
been sequenced (Ghosh et al., 1999; Govan
et al., 2000; Leat et al., 2000), and the nomenclature
established (Van Regenmortel et al.,
2000; Mayo, 2002), but crucially, only sevCorresponding
author: N. Boonham,
[e-mail]
* Manuscript editor: Klaus Hartfelder
eral surveys of bee virus incidence have been
completed (Bruce et al., 1995; Allen and Ball,
1996; Bakonyi et al., 2002; Tentcheva et al.,
2004; Berényi et al., 2006).
Kashmir bee virus (KBV) was first con-
firmed in Apis cerana Fabricius (Bailey and
Woods, 1977), and analysis of the genome sequence
shows that it is a cricket paralysislike
virus (family Dicistroviridae: genus
Cripavirus) (de Miranda et al., 2004; Lanzi
et al., 2006). Like many other bee viruses,
KBV can persist within bees as ‘covert’ infections,
which may be activated in various
ways to an overt and lethal infection (Dall,
1985; Ball, 1997). There is some debate as to
the extent of the pathological nature of this
virus; opinions vary from it being relatively
innocuous to highly pathogenic (Hornitzky,
1987; Anderson and Gibbs, 1988; Anderson,
1991; Ball, 1997). KBV is found in many
parts of the world, including North America
(Bruce et al., 1995; Hung et al., 1996b),
Article published by EDP Sciences and available at http://www.edpsciences.org/apido or http://dx.doi.org/10.1051/apido:2006072
182 L. Ward et al.
Table I. Sequence of the TaqMan primers and probes designed for detection and quantitation of KBV
in honey bees. F: forward primer; R: reverse primer; T: probe. Probes consist of oligonucleotides with a
5’-reporter dye and a 3’-quencher dye (TAMRA: tetra-methylcarboxyrhodamine).
Primer and probe Target Sequence (5’-3’)
AF263725-kbv-83F KBV ACCAGGAAGTATTCCCATGGTAAG
AF263725-kbv-161R KBV TGGAGCTATGGTTCCGTTCAG
AF263725-kbv-109Ta KBV CCGCAGATAACTTAGGACCAGATCAATCACA
AJ307465-955F Bee IPC TGTTTTCCCTGGCCGAAAG
AJ307465-1016R Bee IPC CCCCAATCCCTAGCACG AA
AJ307465-975Tb Bee IPC CCCGGGTAACCCGCTGAACCTC
a Reporter dye is FAM: 6-carboxy-fluorescein.
b Reporter dye is JOETM.
Spain (Allen and Ball, 1995), Germany (Siede
and Büchler, 2003), France (Gauthier et al.,
2003), India (Allen and Ball, 1996), Fiji (Allen
and Ball, 1996), Australia and New Zealand
(Hornitzky, 1981; Anderson, 1983; Hornitzky,
1987; Anderson, 1988; Todd and Ball, 2003).
Distinct sources of KBV have been isolated
in different parts of the world, distinguishable
from one another by comparison of the coat
protein (Allen and Ball, 1995).
The aim of this work was to carry out a survey
of hives in England and Wales to ascertain
the status of KBV. Real-time PCR primers
and a probe were designed for the specific detection
of KBV and to amplify the 18S rRNA
gene from the honey bee host for use as an internal
positive control. An automated extraction
method, based on the use of silica coated
paramagnetic beads was developed to offer
more rapid screening of large numbers of bees.
2. MATERIALS AND METHODS
2.1. Viral samples
Purified KBV isolates were obtained from different
locations and insect species. Isolate KBV 14
(from honey bee in Australia, exact location unknown)
16 (from bumble bee in Auckland, New
Zealand) and KBV NZ (from honey bee in Auckland,
New Zealand). Other purified virus preparations
and virus infected bees and pupae were supplied
by Rothamsted Research (UK), USDA (America)
and HDLGN (Germany). Infected bee samples
were transported at ambient temperatures in 70%
ethanol, and stored at –20 ˚C before analysis.
2.2. Real-time PCR primer
and TaqMan
probe design
Sequence data for coat protein genes from
KBV and the closely related Acute paralysis
virus (ABPV) were downloaded from the EMBL
database to compare inter and intra viral sequence
variability. Multiple sequence alignments
were carried out using the CLUSTAL V algorithm
in the package MegAlign (DNASTAR inc.,
Madison, USA). Real-time PCR primers and a
probe were designed (Primer ExpressTM software,
Applied Biosystems, Branchburg, USA) to a region
of sequence (using accession AF263725) conserved
in KBV but distinct from ABPV. The assay
was tested for cross-reaction against ABPV and the
other bee viruses Black queen cell virus (BQCV),
Sacbrood virus (SBV), Cloudy wing virus (CWV),
Slow paralysis virus (SPV), Deformed wing virus
(DWV), Chronic paralysis virus (CPV) and Apis iridescent
virus (AIV).
Real-time PCR primers and a probe were designed
to the bee 18S rRNA gene of Apis mellifera
(AJ307465) to serve as an internal positive control
(IPC) for assessing nucleic acid extraction effi-
ciency. The 5’ terminal reporter dyes for the probes
were 6-carboxyflurorescin (FAM) and JOETM and
the 3’ quencher was tetra-methylcarboxyrhodamine
(TAMRA) (Tab. I).
2.3. Survey of colonies for KBV
in England and Wales
Adult honey bees were collected from colonies
throughout England and Wales; samples were collected
by Appointed Bee Inspectors and individual
First detection of Kashmir bee virus in the UK 183
beekeepers. Samples were taken from both healthy
and unhealthy hives. All bee samples were placed
directly in 40 mL polypropylene universal bottles
containing 25 mL of 70% ethanol and stored at 4 oC
prior to testing.
2.4. Tissue homogenisation
The non survey samples were tested individually
whilst the survey samples were tested by bulking
5 bees together for each sample, such that larger
number of bees could be tested from each hive.
Non-survey samples: individual bees/wasps were
placed inside 2 mL screw cap micro-centrifuge
tubes with 3 tungsten carbide beads (3 mm) (Qiagen
Ltd, Crawley, UK) and 1 mL of lysis buffer (ThermoLabsystems,
Vantaa, Finland); the tubes were
mounted onto a mixer mill (Qiagen) and shaken
at an amplitude of 30/s for 3 minutes. The tubes
were centrifuged at 6000 g (room temperature) for
3 min to remove debris. UK survey samples: for
the survey samples, two replicates each containing
5 bees, were processed per survey sample. Excess
ethanol was removed from all bees by blotting
on paper towel. Each replicate of 5 bees were
placed in a 100 mm × 150 mm filter grinding bag
(Bioreba, Reinach, Germany) with 5 mL of lysis
buffer (Thermo Labsystems) and ground manually
with a Homex grinder (Bioreba). The lysate was decanted
into a 5 mL screw cap tube. Tubes were spun
at 6000 g for 1 min to pellet debris.
2.5. RNA extraction from Bees
RNA was extracted from the cleared lysate
using a silica-based total RNA extraction kit
(Thermo Labsystems) in conjunction with a magnetic
particle processor (Kingfisher ML, Thermo
Labsystems). The manufacturer’s program ‘Total_RNA_ML_1’
was used. Briefly, Kingfisher
tubes were prepared as follows – tube 1: 1000 µL
of cleared lysate and 50 µL of MagnaSil beads
(Promega); tube 2: 600 µL of lysis buffer b
(Promega); tubes 3 and 4: 1 mL of 70% ethanol;
tube 5: 200 µL of molecular grade sterile water
(BDH, Lutterworth, UK). The resulting RNA eluted
into tube 5 was transferred to a fresh 1.5 mL tube
and stored at –20 ˚C prior to use.
2.6. Real-time PCR assays
All assays were run as simplex assays. Reactions
were set up in either 96 or 384 well reaction
plates using PCR core reagent kits (Applied Biosystems),
following the protocols supplied, but with the
addition of 0.5 units of M-MLV reverse transcriptase
(Promega) per reaction. For each reaction, 1 µL
of total RNA was added, giving a final volume of
25 µL. Plates were then cycled at generic system
conditions (48 ˚C/30 min, 95 ˚C/10 min and 40 cycles
of 60 ˚C/1 min, 95 ˚C/15 s) within the 7900 HT
Sequence Detection System (Applied Biosystems),
using real-time data collection.
2.7. Cloning and sequencing PCR
products
Real-time PCR products were directly ligated
into plasmid pGEM
-T Easy Vector (Promega),
and transformed into E. coli JM109 High Effi-
ciency competent cells (Promega) following the
manufacturer’s protocols. White bacterial colonies
containing plasmids with inserts were selected and
plasmid DNA was purified using the Wizard
Plus
SV miniprep DNA purification system (Promega).
Purified plasmid concentrations were adjusted to
20 ng µL−1 for sequencing. Sequencing was carried
out by the DNAseq sequencing service, University
of Dundee, Scotland.
2.8. Quantification of KBV virus load in
bees
The KBV and bee IPC real-time PCR assays
were used to quantify KBV virus load in positive
UK samples using a relative stand

Kết quả (Việt) 2:

Tóm tắt - rút ong Kashmir (KBV) thường vẫn tồn tại những con ong khi bị nhiễm khuẩn bí mật không có triệu chứng rõ ràng.
Virus này có thể chuyển đổi để trở thành một bệnh nhiễm trùng gây chết người công khai, đặc biệt là sự có mặt của Varroa ve.
Mặc dù virus được phân phối trên toàn thế giới, người ta nghĩ được vắng mặt ở Vương quốc Anh. Một PCR thời gian thực
nghiệm đã được phát triển để phát hiện cụ thể của KBV. Không có phản ứng chéo đã được quan sát với virus ong khác.
KBV được khuếch đại thành công từ giai đoạn sống khác nhau của ong mật ong và từ một con ong bắp cày và ong bumble.
Sử dụng các xét nghiệm PCR thời gian thực, một cuộc khảo sát của tổ ong đã được tiến hành ở Anh và xứ Wales để điều tra sự
hiện diện và phân bố địa lý của các virus. KBV đã được phát hiện trong vòng ba thuộc địa tại hai địa điểm.
Hiệu giá virus trong mẫu dương tính được định lượng và phát hiện có chứa mức độ tương tự như những con ong khác
với nhiễm KBV bí mật. Chúng tôi kết luận rằng KBV có mặt ở Anh và không thể hiện nay được coi là một
căn bệnh kỳ lạ. Việc phát hiện ra KBV ở Vương quốc Anh có ý nghĩa quan trọng đối với chính sách nhập khẩu.
Virus ong Kashmir / Apis mellifera / real-time PCR / phát hiện / khảo sát
1. GIỚI THIỆU
virus Honeybee đã có một trình độ cao
tập tin trong những năm gần đây do liên kết của họ
với Varroa destructor Anderson và Trueman
trong sụp đổ colony (Allen và Ball, 1996;
Ball, 1997; Ball và Bailey, 1997; Nordstrom
et al., 1999; Martin, năm 2001; Bakonyi et al,.
2002; Sumpter và Martin, 2004) và trong
phân tích rủi ro cho nhập khẩu nước thứ ba trong
Hiệp định chung về Thuế quan và Thương mại
- Tổ chức Thương mại Thế giới (GATT-WTO)
vệ sinh và kiểm dịch thực vật (SPS) thỏa thuận
( Brown, 1999; Wehling, 2000). Mặc dù vậy,
nhiều người trong số các virus ong chỉ mới
được giải mã (Ghosh et al 1999,;. Govan
et al, 2000;.. Leat et al, 2000), và danh pháp
thành lập (Van Regenmortel et al,.
2000; Mayo , 2002), nhưng điều quan trọng, chỉ sevCorresponding
tác giả: N. Boonham,
[e-mail]
* biên tập bản thảo: Klaus Hartfelder
khảo sát Eral của tỷ lệ vi rút ong đã
được. hoàn thành (Bruce et al, 1995; Allen và Ball ,
1996; Bakonyi et al, 2002;. Tentcheva et al,.
2004;.. Berényi et al, 2006)
Kashmir rút ong (KBV) là con- đầu tiên
khẳng định trong Apis cerana Fabricius (Bailey và
Woods, 1977), và phân tích các trình tự bộ gen
cho thấy rằng nó là một con dế paralysislike
virus (gia đình Dicistroviridae: chi
Cripavirus) (de Miranda et al, 2004; Lanzi.
et al., 2006). Giống như nhiều virus ong khác,
KBV có thể tồn tại trong vòng ong như nhiễm trùng 'bí mật',
mà có thể được kích hoạt trong nhiều
cách để một nhiễm công khai và gây chết người (Dall,
1985; Ball, 1997). Có một số tranh luận về
mức độ tính chất bệnh lý này
virus; ý kiến khác nhau từ nó là tương đối
vô hại để gây bệnh cao (Hornitzky,
1987; Anderson và Gibbs, 1988; Anderson,
1991; Ball, 1997). KBV được tìm thấy ở nhiều
nơi trên thế giới, bao gồm cả Bắc Mỹ
(Bruce et al, 1995;. Hùng et al, 1996).,
Điều hành bởi khoa học EDP và có sẵn tại http://www.edpsciences.org/apido hoặc http : //dx.doi.org/10.1051/apido: 2.006.072
182 L. Ward et al.
Bảng I. Trình tự mồi TaqMan và đầu dò được thiết kế để phát hiện và định lượng của KBV
ở ong mật ong. F: mồi xuôi; R: mồi ngược lại; T: thăm dò. Đầu dò bao gồm oligonucleotide với một
thuốc nhuộm 5'-phóng viên và một 3'-thức uống thuốc nhuộm (Tamra: tetra-methylcarboxyrhodamine).
Primer và thăm dò Target Sequence (5'-3 ')
AF263725-KBV-83F KBV ACCAGGAAGTATTCCCATGGTAAG
AF263725-KBV-161R KBV TGGAGCTATGGTTCCGTTCAG
AF263725-KBV-109Ta KBV CCGCAGATAACTTAGGACCAGATCAATCACA
AJ307465-955F Bee IPC TGTTTTCCCTGGCCGAAAG
AJ307465-1016R Bee IPC CCCCAATCCCTAGCACG AA
AJ307465-975Tb Bee IPC CCCGGGTAACCCGCTGAACCTC
một loại thuốc nhuộm Reporter là FAM:.
6-carboxy-fluorescein. b Reporter nhuộm là JOETM
Tây Ban Nha (Allen và Ball, 1995), Đức (Siede
và Buchler, 2003), Pháp (Gauthier et al.,
2003), Ấn Độ (Allen và Ball, 1996), Fiji (Allen
và Ball, 1996), Australia và New Zealand
(Hornitzky, 1981 ; Anderson, 1983; Hornitzky,
1987; Anderson, 1988; Todd và Ball, 2003).
nguồn riêng biệt của KBV đã được phân lập
ở các bộ phận khác nhau của thế giới, phân biệt
với nhau bằng cách so sánh của áo
protein (Allen và Ball, 1995 ).
Mục đích của việc này là để thực hiện một cuộc khảo sát
của tổ ong ở Anh và xứ Wales để xác định
tình trạng của KBV. Real-time PCR mồi
và một đầu dò được thiết kế để phát hiện cụ thể
của KBV và để khuếch đại các 18S rRNA
gene từ các máy chủ mật ong để sử dụng như một bộ
điều khiển tích cực. An khai thác tự động
phương pháp, dựa trên việc sử dụng silica bọc
hạt thuận đã được phát triển để cung cấp
sàng lọc nhanh hơn số lượng lớn các loài ong.
2. VẬT LIỆU VÀ PHƯƠNG PHÁP
2.1. Mẫu virus
tinh khiết KBV phân lập được lấy từ khác nhau
địa điểm và các loài côn trùng. Cô lập KBV 14
(từ ong mật tại Úc, chính xác địa điểm không rõ)
16 (từ ong bumble ở Auckland, New
Zealand) và KBV NZ (từ mật ong ong ở Auckland,
New Zealand). Các chế phẩm khác tinh khiết vi rút
và ong bị nhiễm virus và nhộng đã được cung cấp
bởi nghiên cứu Rothamsted (Anh), USDA (Mỹ)
và HDLGN (Đức). Mẫu ong nhiễm
được vận chuyển ở nhiệt độ môi trường xung quanh trong 70%
ethanol, và bảo quản ở -20 C trước khi phân tích.
2.2. Real-time PCR mồi
và TaqMan? thăm dò thiết kế
dữ liệu trình tự gen cho protein áo từ
KBV và tình trạng tê liệt cấp tính liên quan chặt chẽ
virus (ABPV) đã được tải về từ các EMBL
cơ sở dữ liệu để so sánh trình tự của virus liên và nội
biến. Nhiều sự sắp xếp trình tự
đã được thực hiện bằng cách sử dụng thuật toán CLUSTAL V
trong gói MegAlign (DNASTAR inc.,
Madison, Mỹ). Mồi PCR thời gian thực và một
đầu dò được thiết kế (phần mềm Primer ExpressTM,
Applied Biosystems, Branchburg, USA) đến một khu vực
của chuỗi (sử dụng nhập AF263725) được bảo tồn
trong KBV nhưng khác biệt từ ABPV. Xét nghiệm này
đã được thử nghiệm cho phản ứng chéo với ABPV và
virus ong khác vi rút di động Đen hoàng hậu (BQCV),
vi rút Sacbrood (NHNN), virus cánh mây (CWV),
vi rút chậm tê liệt (SPV), virus cánh Deformed
(DWV), Virus mãn tính tê liệt (ĐCSVN) và Apis óng ánh
virus (AIV).
mồi PCR thời gian thực và một đầu dò được thiết kế
để các rRNA gene của Apis mellifera ong 18S
(AJ307465) để phục vụ như là một chứng dương nội
(IPC) để đánh giá axit nucleic khai thác effi-
tính hiệu. 5 'thuốc nhuộm phóng thiết bị đầu cuối cho các đầu dò
là 6-carboxyflurorescin (FAM) và JOETM và
3' là thức uống tetra-methylcarboxyrhodamine
(Tamra) (Tab. I).
2.3. Khảo sát của các thuộc địa cho KBV
ở Anh và xứ Wales
ong mật dành cho người lớn được thu thập từ các thuộc địa
trên khắp nước Anh và xứ Wales; mẫu được thu thập
bằng cách bổ nhiệm Thanh tra viên Bee và cá nhân
phát hiện đầu tiên của virus ong Kashmir ở Anh 183
người nuôi ong. Các mẫu được lấy từ cả hai khỏe mạnh
phát ban và không lành mạnh. Tất cả các mẫu ong được đặt
trực tiếp trong 40 mL polypropylene chai phổ quát
chứa 25 ml ethanol 70% và bảo quản ở 4 oC
trước khi dự thi.
2.4. Mô đồng nhất
Các mẫu khảo sát không được kiểm tra riêng
trong khi các mẫu khảo sát đã được thử nghiệm bởi bulking
5 ong với nhau cho mỗi mẫu, như vậy mà lớn hơn
số ong có thể được kiểm tra từ mỗi tổ ong.
Mẫu Non-khảo sát: con ong / ong được
đặt bên trong 2 mL vít nắp vi máy ly tâm
ống với hạt 3 tungsten carbide (3 mm) (Qiagen
Ltd, Crawley, Vương quốc Anh) và 1 ml dung dịch đệm ly giải (ThermoLabsystems,
Vantaa, Phần Lan); các ống được
gắn vào một máy trộn (Qiagen) và rung động
ở một biên độ 30 / s trong 3 phút. Các ống
được ly tâm ở 6000 g (nhiệt độ phòng) cho
3 phút để loại bỏ mảnh vụn. Mẫu điều tra ở Anh: cho
các mẫu khảo sát, hai lần nhắc lại mỗi có chứa
5 con ong, được xử lý mỗi mẫu khảo sát. Thừa
ethanol đã được gỡ bỏ khỏi tất cả các loài ong bởi thấm
vào khăn giấy. Mỗi lần lặp lại 5 con ong đã được
đặt trong một túi mài 100 mm × 150 mm lọc
(Bioreba, Reinach, Đức) với 5 ml dung giải
đệm (Thermo Labsystems) và mặt đất bằng tay
với một máy xay Homex (Bioreba). Lysate chiết
vào một mL ống nắp vặn 5. Ống được quay
tại 6000 g trong 1 phút để ăn viên mảnh vỡ.
2.5. Chiết RNA từ Ong
RNA được chiết xuất từ các lysate xóa
bằng cách sử dụng một số kit chiết RNA silica
(Thermo Labsystems) kết hợp với một từ
bộ vi xử lý hạt (Kingfisher ML, Thermo
Labsystems). Chương trình của nhà sản xuất 'Total_RNA_ML_1'
đã được sử dụng. Một thời gian ngắn, Kingfisher
ống đã được chuẩn bị như sau - ống 1: 1000 ml
của lysate xóa và 50 ml của hạt MagnaSil
(Promega); ống 2: 600 ml dung giải đệm b
(Promega); ống 3 và 4: 1 ml ethanol 70%;
ống 5: 200 ml nước vô trùng lớp phân tử
(BDH, Lutterworth, Vương quốc Anh). Các RNA kết quả tách rửa
vào ống 5 đã được chuyển giao cho một tươi 1,5 mL ống
và bảo quản ở -20 C trước khi sử dụng.
2.6. Real-time PCR xét nghiệm
tất cả các xét nghiệm đã được chạy như xét nghiệm simplex. Phản ứng
đã được thiết lập trong hoặc 96 hoặc 384 phản ứng cũng
tấm bằng PCR kits lõi thuốc thử (Applied Biosystems),
sau các giao thức cung cấp, nhưng với sự
bổ sung của 0,5 đơn vị của M-MLV sao chép ngược
(Promega) mỗi phản ứng. Đối với mỗi phản ứng, 1 ml
tổng RNA đã được thêm vào, cho một khối lượng cuối cùng của
25 ml. Các đĩa được rồi đạp xe tại hệ thống chung
điều kiện (48 C / 30 phút, 95 C / 10 phút và 40 chu kỳ
của 60 C / 1 phút, 95 C / 15 s) trong HT 7900
Hệ thống phát hiện Sequence (Applied Biosystems ),
sử dụng thu thập dữ liệu thời gian thực.
2.7. PCR Cloning và trình tự
các sản phẩm
sản phẩm Real-time PCR đã được trực tiếp ligated
vào plasmid pGEM? -T Easy Vector (Promega),
và chuyển đổi thành E. coli JM109 cao Effi-
tế bào ciency có thẩm quyền (Promega) theo
giao thức của nhà sản xuất. Khuẩn lạc màu trắng
có chứa plasmid với chèn đã được lựa chọn và
plasmid DNA đã tinh khiết sử dụng Plus Wizard?
SV hệ thống lọc miniprep DNA (Promega).
Nồng độ plasmid tinh khiết được điều chỉnh
20 ng ml-1 cho giải trình tự. Trình tự đã được thực
hiện bởi các dịch vụ DNAseq trình tự, Đại học
Dundee, Scotland.
2.8. Định lượng vi rút KBV tải trong
ong
Các KBV và ong IPC thời gian thực nghiệm PCR
được sử dụng để xác định số lượng vi rút KBV tải trong dương
mẫu Anh bằng cách sử dụng một lập trường tương đối