African Journal of Biotechnology Vo

African Journal of Biotechnology Vol. 9(42), pp. 7134-7140, 18 October, 2010
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB10.1040
ISSN 1684–5315 © 2010 Academic Journals
Full Length Research Paper
Organic metabolites produced by Vibrio
parahaemolyticusstrain An3 isolated from Goan mullet
inhibit bacterial fish pathogens
Anju Pandey, Milind M. Naik and S. K. Dubey*
Department of Microbiology, Laboratory of Bacterial Genetics and Environmental Biotechnology, Goa University, Goa,
India.
Accepted 17 September, 2010
Identification and action of several antibacterial metabolites produced by a fish pathogenVibrio
parahaemolyticusstrain An3 from marine ecosystem of Goa has been demonstrated. Antibacterial
activity of the crude cell extract of the test bacterium has been evaluated against indicator pathogenic
bacterial strains such as Acinetobacter sp. An2, Aeromonas hydrophila strain An4, Staphylococcus
arlettae strain An1 andAlteromonas aurentia strain SE3 by agar well diffusion method which clearly
demonstrated comparatively more significant inhibitory effect on indicator bacteria as compared to
several commonly used antibiotics. Gas chromatography mass spectrometry (GC-MS) analysis of crude
cell extract of the test organism interestingly revealed presence of indole, phenyl acetic acid, n-(3-methyl-1, 2, 4-oxadiazol-5-yl) - 1- pyrrolidine carboximidamide, pyrrolopyrazines, tetramethyl pyrazine
and other important phenolic compounds which may beresponsible for antibacterial activity against
indicator microorganisms tested. It has been clearly demonstrated that V. parahaemolyticus strain An3
produced several medically important organic metabolites during cultivation suggesting it as a
potential candidate for production of several antibacterial metabolites to control pathogenic bacterial
strains causing serious fish and human diseases.
Key words:Antibacterial, gas chromatography mass spectrometry, metabolites, pathogenic bacteria, well
diffusion.
INTRODUCTION
There is an increasing demand of therapeutic drugs from
diverse natural resources. After many years of extensive
research, the importance of terrestrial bacteria as source
of valuable bioactive compounds has been very well
established and exploited. As a result, the ocean and
metabolites of marine organisms including associated
*Corresponding author. E-mail: [e-mail].
Tel: [phone].
Fax: [phone].
Abbreviations: GC-MS,Gas chromatography mass
spectrometry; PCR ,polymerase chain reaction; SYEP,sea
water based yeast extract peptone agar; TCBS,thiosulfate
citrate bile salts sucrose; TSI,triple sugar iron; ONPG,o-nitrophenyl-β-d-galactopyranoside; VP,Voges-Proskauer;
BLAST,basic local alignment search tool.
microorganisms have now become the main focus of
drug discovery research (Finical, 1993).These studies are
concerned with bacteria and fungi isolated from sea
water, sediments, invertebrates and fish (Kelecom, 2002).
Bacteria occurring in aquatic ecosystems may have the
ability to inhibit the growth of other microorganisms by
producing antimicrobial substances such as antibiotics
and bacteriocins. Their inhibitory mechanisms include:(i)
Production of antibiotics, bacteriocins, siderophores,
lysozymes, and proteases and (ii) alteration of pH through
production of organic acids (Jorquera et al., 1999).
Vibrio spp. are common inhabitants of aquatic environ-ment and are found free living as well as associated with
various marine organisms such as squids, shrimps,
corals, fish, molluscs, seagrasses and sponges. Some
species are found as symbionts in specialized luminous
organs of marine fish and invertebrates, whereasa number
of other species are well-known pathogens of humans or
marine animals (Thompson et al., 2004). Vibrio
paraheamolyticusis one of the leading pathogens causing
fish and human diseases. Recently, several biologically
active substances have been isolated from marine
bacteria. There are many reports about antibacterialactivity
shown by marine bacteria; Pseudomonas, Yersinia,
Aeromonas, Brevibacterium, Bacillusand Alteromonas
(Gauthier and Breittmayer, 1979; Shiozawa et al., 1997;
Jorquera et al., 1999; Khalil et al., 2006; Ahmed etal.,
2008; Rahman et al., 2010). There are few reports on
vibriosproducing antimicrobial substances (Sugita et al.,
1997; Long and Azam, 2001; Castro et al., 2002; Hjelm et
al., 2004; Norhana and Darah, 2005). In our investigation
we have reported organic metabolites of afish pathogenic
strain of V. parahaemolyticus which inhibited the growth
of other bacterial fish pathogens. We have further
characterized these metabolites by gas chromatography
mass spectrometry (GC-MS).
MATERIAL AND METHODS
Isolation and screening of marine bacteria
Different marine fishes with visible symptoms of hemorrhage and
lesions on their body parts were selected; infectedregions such as
mouth, fins and gills were washed under sterile conditions with
sterile deionized double distilled water and swabbed with sterile
cotton wool. Suspension of this swab was prepared in saline and
used for isolation of pathogenic bacteria on nutrient agar plates by
serial dilutions.
Morphological characterization
The colony characteristics of the selected bacterial isolate; size,
shape, colour, margin, elevation, consistency and opacity were
observed and recorded. The selected bacterial isolate was gram
stained and observed under the light microscope at 100 x magni-fication to study the cell morphology.
Identification of test bacterium using biochemical tests
Hi-Media (India) kit for biochemical tests was usedto tentatively
identify this bacterial isolate and results were interpreted according
to Bergey’s Manual of Systematic Bacteriology (Krieg and Holt,
1984).
Molecular identification
Further confirmation of genus and species of the test bacterium
was done by 16S rDNA sequencing and NCBI–BLAST search
(Altschul et al., 1990). The genomic DNA was extracted from the
bacterial isolates and used as template for polymerase chain
reaction (PCR) amplification of the 16S rDNA fragment (1400 bps)
according to standard procedure (Sambrook et al., 1989). The
following eubacterial primers were used for PCR amplification:
27 f (5’- AGAGTTTGATCCTGGCTCAG -3’)
1492 r (5’- GGTTACCTTGTTACGACTT -3’)
These primers were purchased from MWG Biotech IndiaPvt. Ltd.,
Bangalore, India.
Pandey et al. 7135
Antibiotic susceptibility test
Overnight grown bacterial suspension (0.1 mL) of indicator
pathogenic bacteria Acinetobacter sp. strain An2 (Accession no.
FJ38695), Aeromonas hydrophila strain An4 (accession no.
FJ386959), Staphylococcus arlettae strain An1 (accession no.
FJ386956) andAlteromonas aurentia strain SE3 was spread plated
on Mueller Hinton agar plates; octadiscs (OD-007 and 014 from Hi-Media, India) containing multiple antibiotics were carefully placed in
the center of the agar plates and incubated at roomtemperature
(27°C) for 24 h. Sensitivity of the individual indicator bacterial
isolate to a particular antibiotic was determined a ccording to the
performance standards of antibiotic disc susceptibility test approved
by National Committee for Clinical Laboratory Standards (Bauer et
al., 1966).
Preparation of crude cell extract
Ethyl acetate extraction procedure was followed with a slight modifi-cation to extract antimicrobial metabolites from the test bacterium
(Wratten et al., 1977). Test organism was grown on sea water
based yeast extract peptone agar (SYEP) agar. After48 h, agar
along with the cells was cut into pieces and suspended into ethyl
acetate to extract the antibacterial metabolites. Overnight suspend-sion was decanted followed by centrifugation to getcell free solvent.
Solvent was subjected to evaporation at 40°C for final recovery of
crude extract (Ahmed et al., 2008). Simultaneously,48 h old culture
suspension of the test bacterium was centrifuged toget cell free
supernatant.
Antimicrobial bioassay (agar well diffusion test)
In order to check the antibacterial activity of thecell extract, SYEP
agar (1.2%) was poured in the plates, small wells of about 6 mm
diameter were made in the agar plates and bottom ofthe wells
were sealed by 0.7% molten SYEP agar (Abraham, 2004). 100 µl
crude cell extract and cell free supernatant were poured in the wells
separately and allowed to diffuse in the agar mediafor four hours.
Different indicator bacterial strains were spread plated on separate
SYEP agar plates. Ethyl acetate (100 µl) was used as a control to
check its inhibitory effect.
GC-MS analysis of crude cell extract
Identification of the antibacterial metabolites wasdone by GC-MS
analysis; injecting 1 µl of sample into a RTX-5 column (7 m x 0.32
mm) of GC-MS (model GC-MS-QP-2010 plus) from Shimadzu,
Japan and Helium (3 ml/min) was used as a carrier gas. The
following temperature gradient program was used: 75°C for 2 min
followed by an increase from 75 to 175°C at a rate of 50°C per min
and finally 7 min at 175°C. The m/z peaks representing mass to
charge ratio characteristic of the antimicrobial fractions were com-pared with those in the mass spectrum library of the corresponding
organic compounds.
RESULTS
Morphological and biochemical characterization of
test bacterium
This bacterial isolate appeared as spherical (2 - 3 mm
diameter), dark green colonies on thiosulfate citrate bile
7136 Afr. J. Biotechnol.
Table 1. Comparison of antibacterial activity of V. parahaemolyticus strain An3 with commonly used antibiotics on indicator
bacterial isolates.
Antibiotic (µg/ml)
Zone of clearance (diameter) of indicator bacteria
Acinetobacter
sp. strain An2
(mm)
Aeromonas
hydrophila strain
An4 (mm)
A. aurentia
strain SE3 (mm)
S. arlettae
strain An1
(mm)
Amicacin- (Ak) 10 7 7 3 0
Carbenicillin- (Cb) 1

Kết quả (Việt) 1:

Các tạp chí Châu Phi của công nghệ sinh học tập 9(42), pp. 7134-7140, 18 tháng 10, 2010 Có sẵn trực tuyến tại http://www.academicjournals.org/AJB DOI: 10.5897/AJB10.1040 ISSN 1684-5315 © 2010 học tạp chí Chiều dài đầy đủ nghiên cứu giấy Chất chuyển hóa hữu cơ được sản xuất bởi Vibrio parahaemolyticusstrain An3 cô lập từ Goan mullet ức chế tác nhân gây bệnh do vi khuẩn cá Anju Pandey, Milind M. Nguyễn thị và S. K. Dubey * Vùng của vi sinh học, Phòng thí nghiệm vi khuẩn di truyền và môi trường công nghệ sinh học, đại học Goa, Goa, Ấn Độ. Được chấp nhận tháng chín 17, 2010 Xác định và hành động của một số kháng khuẩn chất chuyển hóa được sản xuất bởi một cá pathogenVibrioparahaemolyticusstrain An3 từ hệ sinh thái biển Goa đã được chứng minh. Kháng khuẩn hoạt động của các chiết xuất dầu thô tế bào vi khuẩn thử nghiệm đã được đánh giá chống lại chỉ số gây bệnh các chủng vi khuẩn như Acinetobacter sp. An2, Aeromonas hydrophila căng thẳng An4, Staphylococcus căng thẳng arlettae An1 andAlteromonas aurentia căng thẳng SE3 bởi agar cũng phổ biến phương pháp mà rõ ràng chứng minh có hiệu lực ức chế tương đối đáng kể trên chỉ số vi khuẩn như so với một số thuốc kháng sinh thường được sử dụng. Sắc ký khí mass spectrometry (GC-MS) phân tích của thô chiết xuất tế bào của sinh vật thử nghiệm điều thú vị tiết lộ sự hiện diện của indol, phênyl axit axetic, n-(3-methyl-1, 2, 4-oxadiazol-5-yl) - 1-pyrrolidine carboximidamide, pyrrolopyrazines, tetramethyl pyrazine và hợp chất nhựa phenol quan trọng khác mà có thể beresponsible cho các hoạt động kháng khuẩn đối với chỉ số vi sinh vật được thử nghiệm. Nó đã được rõ ràng chứng minh rằng V. parahaemolyticus căng thẳng An3 sản xuất nhiều chất chuyển hóa hữu cơ về mặt y tế quan trọng trong trồng trọt cho thấy nó như là một ứng cử viên tiềm năng để sản xuất một số chất chuyển hóa kháng khuẩn để kiểm soát vi khuẩn gây bệnh chủng gây ra nghiêm trọng cá và bệnh của con người. Key từ: kháng khuẩn, sắc ký khí mass spectrometry, chất chuyển hóa, vi khuẩn gây bệnh, tốt phổ biến. GIỚI THIỆU Có là một nhu cầu ngày càng tăng của các loại thuốc điều trị từ tài nguyên thiên nhiên đa dạng. Sau nhiều năm mở rộng nghiên cứu, tầm quan trọng của vi khuẩn trên mặt đất là nguồn Các hợp chất hoạt tính sinh học có giá trị đã rất tốt được thành lập và khai thác. Kết quả là, đại dương và chất chuyển hóa của các sinh vật biển trong đó có liên quan đến * Tác giả tương ứng. E-mail: [e-mail]. Điện thoại: [phone]. Fax: [phone]. Chữ viết tắt: GC-MS, sắc ký khí hàng loạt spectrometry; Đảng Cộng sản Romania, các phản ứng chuỗi trùng hợp; SYEP, biển nước dựa nấm men chiết xuất chế phẩm peptone agar; TCBS, thiosunfat citrat mật muối Sucroza; TSI, ba đường sắt; ONPG, o-nitrophenyl-β-d-galactopyranoside; VP, Voges-Proskauer; Vụ nổ, công cụ tìm kiếm cơ bản liên kết địa phương. vi sinh vật đã trở thành mục tiêu chính của nghiên cứu phát hiện ra thuốc (Finical, 1993).Các nghiên cứu có liên quan với vi khuẩn và nấm bị cô lập từ biển nước, trầm tích, xương sống và cá (Kelecom, 2002). Vi khuẩn xảy ra trong hệ sinh thái thủy sinh có thể có các có thể ức chế sự phát triển của vi sinh vật khác bởi sản xuất chất kháng sinh chẳng hạn như thuốc kháng sinh và bacteriocins. Include:(i) cơ chế ức chế của họ Sản xuất thuốc kháng sinh, bacteriocins, siderophores,Lysozyme, và protease và (ii) thay đổi pH thông qua sản xuất các axit hữu cơ (Jorquera và ctv., 1999). Vibrio spp. chung cư dân của thủy sản environ-ment và được tìm thấy miễn phí sinh hoạt cũng như liên kết với Các sinh vật biển chẳng hạn như bạch tuộc, tôm, San hô, cá, động vật thân mềm, nguên và bọt biển. Một số loài này được tìm thấy như symbionts trong chuyên ngành sáng Các cơ quan của cá biển và xương sống, whereasa số những loài khác đang nổi tiếng tác nhân gây bệnh của con người hoặc động vật biển (Thompson et al, 2004). Vibrio paraheamolyticusis một trong những tác nhân gây bệnh hàng đầu gây ra cá và bệnh của con người. Gần đây, một số sinh học chất hoạt động đã bị cô lập từ marine vi khuẩn. Có rất nhiều báo cáo về antibacterialactivity Hiển thị do vi khuẩn biển; Pseudomonas, Yersinia,Aeromonas, Brevibacterium, Bacillusand Alteromonas (Gauthier và Breittmayer, năm 1979; Shiozawa et al., 1997; Jorquera et al., 1999; Khalil et al., 2006; Ahmed etal., năm 2008; Rahman et al., 2010). Có những báo cáo vài ngày chất kháng khuẩn vibriosproducing (Sugita et al., năm 1997; Dài và Azam, năm 2001; Castro et al., 2002; Hjelm et và những người khác, năm 2004; Norhana và Darah, 2005). Trong điều tra của chúng tôi chúng tôi đã báo cáo chất chuyển hóa hữu cơ của afish gây bệnh căng thẳng của V. parahaemolyticus mà ức chế sự phát triển của các tác nhân gây bệnh do vi khuẩn cá. Chúng tôi có thêm đặc trưng các chất chuyển hóa bởi sắc ký khí MASS spectrometry (GC-MS). VẬT LIỆU VÀ PHƯƠNG PHÁP Cô lập và kiểm tra của biển vi khuẩn Cá biển khác nhau với các triệu chứng có thể nhìn thấy của xuất huyết và tổn thương trên các bộ phận cơ thể đã được lựa chọn; infectedregions chẳng hạn như miệng, vây và mang đã được rửa sạch trong các điều kiện vô trùng với vô trùng deionized đôi nước cất và swabbed với vô trùng Bông tự nhiên dùng. Hệ thống treo của tăm bông này đã được chuẩn bị trong dung dịch muối và được sử dụng cho sự cô lập của các vi khuẩn gây bệnh trên dinh dưỡng agar tấm bởi nối tiếp dilutions.Đặc tính hình Thái Các đặc tính thuộc địa của vi khuẩn đã chọn cô lập; Kích thước, hình dạng, màu sắc, lợi nhuận, vị, nhất quán và độ mờ quan sát và ghi lại. Vi khuẩn isolate đã chọn là gram màu và quan sát dưới kính hiển vi ánh sáng tại 100 x magni-fication để nghiên cứu hình thái học di động. Nhận dạng của vi khuẩn thử nghiệm bằng cách sử dụng các xét nghiệm sinh hóa Hi-phương tiện truyền thông (Ấn Độ) bộ cho các xét nghiệm sinh hóa là từng không chắc chắn xác định này isolate do vi khuẩn và kết quả đã được giải thích theo để hướng dẫn sử dụng của Bergey của hệ thống vi sinh học (để và Holt, 1984). Nhận dạng phân tử Hơn nữa xác nhận của chi và loài vi khuẩn thử nghiệm đã được thực hiện bởi 16 rDNA trình tự và NCBI-BLAST tìm (Altschul et al., 1990). DNA gen được chiết xuất từ các vi khuẩn cô lập và sử dụng làm mẫu cho chuỗi polymerase phản ứng (PCR) khuếch đại của đoạn 16 rDNA (1400 bps) theo thủ tục tiêu chuẩn (Sambrook và ctv., 1989). Các sau eubacterial chất nền, mồi được sử dụng cho Đảng Cộng sản Romania khuếch đại: 27 f (5'-AGAGTTTGATCCTGGCTCAG-3 ') 1492 r (5'-GGTTACCTTGTTACGACTT-3 ') Các chất nền, mồi đã được mua từ MWG công nghệ sinh học IndiaPvt. Công ty TNHH, Bangalore, Ấn Độ. Pandey et al. 7135 Kháng sinh nhạy cảm thử nghiệm Qua đêm phát triển vi khuẩn đình chỉ (cách 0.1 mL) chỉ số vi khuẩn gây bệnh Acinetobacter sp. căng thẳng An2 (gia nhập không. FJ38695), Aeromonas hydrophila căng thẳng An4 (gia nhập không. FJ386959), Staphylococcus arlettae căng thẳng An1 (gia nhập không. FJ386956) andAlteromonas aurentia căng thẳng SE3 cư mạ trên Mueller Hinton agar đĩa; octadiscs (OD-007 và 014 từ Hi-phương tiện truyền thông, Ấn Độ) có chứa nhiều thuốc kháng sinh đã được cẩn thận đặt trong Trung tâm của agar tấm và ủ tại roomtemperature (27° C) cho 24 h. nhạy cảm của các chỉ số cá nhân do vi khuẩn isolate để một kháng sinh đặc biệt đã được xác định một ccording để các hiệu suất tiêu chuẩn của bài kiểm tra tính nhạy cảm kháng sinh đĩa được phê duyệt bởi các ủy ban quốc gia cho phòng thí nghiệm lâm sàng tiêu chuẩn (Bauer et Al., 1966). Chuẩn bị di động thô chiết xuất Axetat etyl khai thác thủ tục được theo sau với một bổ nhẹ cation để trích xuất các chế phẩm kháng chất chuyển hóa từ vi khuẩn thử nghiệm(Wratten et al., 1977). Kiểm tra sinh vật đã được trồng trên nước biển Dựa trên nấm men chiết xuất chế phẩm peptone agar agar (SYEP). After48 h, agar cùng với các tế bào là cắt thành miếng và bị đình chỉ vào ethyl axetat để trích xuất các chất chuyển hóa kháng khuẩn. Đình chỉ qua đêm-sion decanted tiếp theo số là dung môi miễn phí getcell. Dung môi đã phải chịu để bay hơi ở 40° C cho thu hồi cuối cùng thô giải nén (Ahmed và ctv., 2008). Đồng thời, 48 h văn hóa cũ đình chỉ thử nghiệm vi khuẩn là tế bào thoát ly miễn phí supernatant. Các chế phẩm kháng bioassay (thạch phổ biến cũng thử nghiệm) Để kiểm tra kháng khuẩn hoạt động của thecell giải nén, SYEP Agar (1.2%) được đổ vào các tấm, wells nhỏ của khoảng 6 mm đường kính đã được thực hiện trong agar tấm và dưới cùng của các giếng được lấp kín bởi 0,7% nóng chảy SYEP agar (Abraham, năm 2004). 100 ml trích xuất các tế bào thô và di động miễn phí supernatant đã được đổ vào các giếng một cách riêng biệt và có thể khuếch tán trong agar mediafor bốn giờ. Các chủng vi khuẩn khác nhau chỉ số đã được lan truyền mạ ngày riêng biệt SYEP agar tấm. Axetat etyl (100 ml) đã được sử dụng như là một điều khiển để kiểm tra tác dụng ức chế của nó. GC-MS phân tích chiết xuất thô di động Nhận dạng của chất chuyển hóa kháng khuẩn wasdone bởi GC-MS phân tích; tiêm 1 ml của mẫu vào một cột của tôi-5 (7 m x 0,32 mm) của GC-MS (mẫu GC-MS-QP-2010 cộng với) từ Shimadzu, Nhật bản và heli (3 ml/phút) được sử dụng như một chất khí tàu sân bay. Các Sau chương trình gradient nhiệt độ đã được sử dụng: 75° C cho 2 phút theo sau sự gia tăng từ 75 đến 175° C tốc độ 50° C cho mỗi phút và cuối cùng 7 phút ở 175° C. Các đỉnh núi m/z đại diện cho khối lượng tới tỷ lệ phí đặc trưng của các phần phân đoạn của kháng sinh được pared com với những người ở thư viện quang phổ khối lượng tương ứng hợp chất hữu cơ. KẾT QUẢ Đặc tính hình thái học và hóa sinh của kiểm tra vi khuẩn Isolate vi khuẩn này xuất hiện như hình cầu (2-3 mmđường kính), tối màu xanh lá cây thuộc địa trên thiosunfat citrat mật 7136 Afr. J. Biotechnol. Bảng 1. So sánh các hoạt động kháng khuẩn của V. parahaemolyticus chủng An3 với thuốc kháng sinh thường được sử dụng trên chỉ số vi khuẩn cô lập.Kháng sinh (μg/ml) Khu vực giải phóng mặt bằng (đường kính) chỉ số vi khuẩn Acinetobactercăng thẳng SP. An2(mm) Aeromonas hydrophila căng thẳngAn4 (mm) A. aurentia căng thẳng SE3 (mm)S. arlettaecăng thẳng An1 (mm) Amicacin-(Ak) 10 7 7 3 0 Carbenicillin-(Cb) 1